Labshake search
Citations for Macherey-Nagel GmbH :
151 - 200 of 2293 citations for Human Gap Junction Alpha 8 Protein CX50 GJA8 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: RNA was extracted using either the Qiagen RNeasy kit or the Macherey Nagel RNAplus kit (Macherey-Nagel, Düren, Germany). RNA-seq libraries were prepared using the TruSeq Stranded mRNA Sample Prep (Illumina ...
-
bioRxiv - Biochemistry 2020Quote: ... After proteolytic cleavage the protein was incubated with 1.5 g Protino Ni-IDA resin (Macherey-Nagel, Düren, Germany) for 25 min at 4°C to remove His6-SUMO (for purification of SUMO-Hsc70 overnight digestion with Ulp1 and second incubation with Protino Ni-IDA was omitted) ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were run on bis-acrylamide gels and then transferred to PVDF membranes (Macherey-Nagel, Düren, Germany) using a Trans-blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: Spike peptide-stimulated splenocytes split were used for RNA extraction by using the sNucleoSpin™ Kit Plus kit (Macherey-Nagel). cDNA was generated by using a high-capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... NucleoSpin® plasmid isolation kit and NucleoSpin® gel and PCR clean-up kit were purchased from Macherey-Nagel (Germany). PierceTM protease inhibitor tablets EDTA free and Pierce™ high capacity Ni-IMAC resin were purchased from Thermo Scientific (international) ...
-
bioRxiv - Bioengineering 2022Quote: ... purified using PCR clean-up kit (Macherey-Nagel), and transformed in electrocompetent E ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NucleoSpin Plant II kit (Macherey-Nagel).
-
bioRxiv - Bioengineering 2020Quote: ... NucleoSpin® Plasmid EasyPure Kit (Macherey-Nagel, Germany) was used for plasmid preparation ...
-
bioRxiv - Microbiology 2021Quote: ... or cells (NucleoSpin RNA plus kit, Macherey-Nagel) at different time post-electroporation (4 hpe – 7 dpe) ...
-
bioRxiv - Microbiology 2021Quote: ... using the NucleoSpin Plasmid Mini Kit (Macherey-Nagel) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... or the NucleoSpin Blood XL kit (Macherey-Nagel), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... produced using an endotoxin-free kit (Macherey-Nagel), were co-injected with the I-SceI meganuclease (Grabher et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NucleoSpin® RNA kit (Macherey-Nagel, #740955.250) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Genomics 2022Quote: ... The Nucleospin® Tissue kit (Macherey-Nagel, Germany) was used for bacterial DNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by NucleoSpin RNA kit (Macherey-Nagel). Then rRNA depletion was performed with the RiboMinus Eukaryote System v2 (Invitrogen–Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we used the Nucleospin Kit (Macherey-Nagel, USA) following manufacturer guidelines but with 60 µl instead of 100 µl of elution buffer added in the final step ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a NucleoSpin RNA extraction kit (Macherey-Nagel), treated with Turbo DNase (Ambion) ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Neuroscience 2023Quote: ... NucleoSpin RNA XS kit (Macherey-Nagel; Düren, Germany), or TRIzol Reagent with phenol-chloroform extraction (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Zoology 2023Quote: ... or the NucleoSpin® Tissue Kit (Macherey-Nagel). At least one specimen per site was sequenced for two standard markers ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Neuroscience 2023Quote: ... using the NucleoSpin RNA purification kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... or NucleoBond Xtra Midi EF kit (MACHEREY-NAGEL).
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmid kits were purchased from Macherey-Nagel. Precision Plus ProteinTM protein standard was provided by Biorad ...
-
bioRxiv - Microbiology 2022Quote: ... using the NucleoSpin RNA virus kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using the NucleoSpin RNA Plus kit (MACHEREY-NAGEL GmbH & Co ...
-
bioRxiv - Genomics 2022Quote: ... or the NucleoMagVet kit (Macherey-Nagel, Düren, Germany) on a KingFisher® extraction platform (Thermo-Fisher-Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... kit with NTB binding buffer (#740595.150, Macherey-Nagel) according to the manufacturer’s instructions and eluted in 30 µL.
-
bioRxiv - Genomics 2022Quote: ... NucleoSpin miRNA Plasma Kit (NUC; Macherey-Nagel, 740981.50), QIAamp ccfDNA/RNA Kit (CCF ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using Nucleospin kit (Macherey-Nagel, Düren, Germany), and subcloned into pGEM-T plasmid ...
-
bioRxiv - Plant Biology 2024Quote: ... using the NucleoSpin RNA Plant Kit (Macherey-Nagel). 700ul of the lysis buffer was used ...
-
bioRxiv - Immunology 2024Quote: ... Micro kit for RNA purification (740902, Macherey-Nagel) according manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: ... DNA gel extraction kit from Macherey-Nagel (Germany), trizol reagent ...
-
bioRxiv - Biochemistry 2024Quote: ... and NucleoBond Xtra Midi kit (MACHEREY-NAGEL, 740410.50).
-
bioRxiv - Plant Biology 2024Quote: ... using NucleoSpin® RNA Plant kit (Macherey-Nagel). RNAs were quantified by QuBit (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... isolated with NucleoSpin Tissue Mini Kit (Macherey-Nagel), was used as PCR template ...
-
bioRxiv - Biochemistry 2024Quote: ... coli cells with GigaPrep extraction kits (Macherey-Nagel) and contained four Widom 601 sequences equally spaced by 30 bp linker DNA ...
-
bioRxiv - Genetics 2021Quote: ... The lysates were then purified to genomic DNA and RNA using NucleoSpin Tissue Kits and NucleoSpin RNA Plus kits (MACHEREY-NAGEL), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from single legs of individual mosquitoes or whole individual mosquitoes using NucleoSpin DNA Insect Kit (Machery-Nagel) or NucleoSpin Tissue Kit (Macherey-Nagel) following the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2020Quote: ... membrane-extracted proteins were supplemented with 20 mM imidazole and incubated with Protino Ni-NTA agarose beads (Macherey-Nagel) for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were purified from cell-free lysate by metal ion affinity chromatography with Protino Ni-NTA Agarose (Macherey-Nagel) as matrix followed by ultrafiltration (Amicon Ultra-15 centrifugal filter units ...
-
bioRxiv - Biochemistry 2021Quote: ... and the GST fusion proteins were purified using Protino gluthathione agarose 4B according to the manufacturer’s instruction (Macherey-Nagel). SPR interaction studies were performed according to previous studies46,85 ...
-
bioRxiv - Plant Biology 2022Quote: ... Proteins from the soluble fraction were purified by affinity chromatography with Protino Ni-TED PackedColumns2000 (Macherey-Nagel, Düren, Germany) based on the His-tag tail ...
-
bioRxiv - Molecular Biology 2024Quote: After Ni2+-NTA agarose purification (see above) the proteins were additionally purified by Protino Ni-TED 1000 (Macherey-Nagel) followed by FPLC gel filtration (see above) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting PCR product was purified using a standard PCR purification kit (NucleoSpin® Gel and PCR Clean-up kit, Macherey-Nagel) and used as a template for the second PCR that used the gene-specific forward primer and a 3’ T7 universal reverse primer targeting the forward linker sequence for the antisense probe ...
-
bioRxiv - Microbiology 2023Quote: ... exonuclease V was used to digest the linear DNA in the sample prior to isolation of the residual putative cirDNA using a DNA clean-up kit (NucleoSpin gel and PCR clean-up kit, Macherey-Nagel, Germany). The final cirDNA preparation was dissolved in TE buffer ...