Labshake search
Citations for Macherey-Nagel GmbH :
101 - 150 of 2127 citations for Rabbit S100 Calcium Binding Protein A6 S100A6 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... NucleoSpin RNA extraction kit (Macherey-Nagel, #740955.50) was used following the manufacturer’s specifications ...
-
bioRxiv - Bioengineering 2022Quote: ... NucleoSpin® RNA purification kit (Macherey-Nagel), SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... and a Nucleospin RNA kit (Macherey-Nagel). rRNA was removed with the Ribo-Zero Gold rRNA Removal Kit (Illumina) ...
-
bioRxiv - Cell Biology 2021Quote: ... Mini kit for RNA purification (Macherey-Nagel). The purified mRNA was fragmented and primed with random hexamers ...
-
bioRxiv - Microbiology 2020Quote: ... and Nucleospin® RNA kit (Macherey-Nagel) according to the manufacturers’ protocol.
-
bioRxiv - Microbiology 2020Quote: The NucleoSpin RNA extraction kit (Macherey-Nagel) was used to isolate total intracellular RNA according to the manufacturer’s specification ...
-
bioRxiv - Genomics 2022Quote: ... using the Nucleospin virus kit (Macherey-Nagel). Purified DNA was subsequently used for PCR amplification with the following primers ...
-
bioRxiv - Biochemistry 2021Quote: ... Mini kit for plasmid DNA (Macherey-Nagel). To obtain linear DNA of the indicated length ...
-
bioRxiv - Genomics 2020Quote: ... or NucleoSpin Blood Kit (Macherey-Nagel, Germany). SV breakpoints were confirmed with Sanger Sequencing where possible ...
-
bioRxiv - Molecular Biology 2020Quote: ... NucleoBond Xtra Midi kit (Macherey-Nagel; 740412.50) was used.
-
bioRxiv - Microbiology 2021Quote: A NucleoBond Xtra midi kit (Macherey-Nagel) and a QIAamp DNA minikit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... or NucleoSpin RNA extraction kit (Macherey-Nagel) and used in quantitative reverse transcription PCR (RT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... a NucleoSpin Plant II kit (Macherey-Nagel) for the Seven-parent-MAGIC and NORFAB panels ...
-
bioRxiv - Microbiology 2022Quote: ... The nucleoSpin plasmid easypure Kit (Macherey-Nagel) was used for plasmid purification and expression cassettes were sequence verified ...
-
bioRxiv - Genetics 2023Quote: ... using the RNA-Plus kit (Macherey-Nagel), and libraries were prepared with 1μg of total RNA using the NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... NucleoSpin Plasmid EasyPure Kit (Macherey-Nagel, Germany) was used for plasmid preparation ...
-
bioRxiv - Plant Biology 2023Quote: The NucleoSpin RNA extraction kit (Macherey-Nagel) was used to extract total RNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... or NucleoSpin Tissue XS kit (Macherey-Nagel) according to manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... Mini kit for plasmid DNA (Macherey-Nagel). Correct mutation of the plasmids was verified by sequencing performed by MicroSynth GmbH Göttingen.
-
bioRxiv - Molecular Biology 2024Quote: ... the NucleoSpin Plasmid Mini kit (MACHEREY-NAGEL) was used for minipreparations ...
-
bioRxiv - Physiology 2019Quote: ... RNA was isolated and cDNA was formed using commercial kits according to manufacturer’s instructions (NucleoSpin miRNAs kit; Macherey-Nagel, Düren ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted using either the Qiagen RNeasy kit or the Macherey Nagel RNAplus kit (Macherey-Nagel, Düren, Germany). RNA-seq libraries were prepared using the TruSeq Stranded mRNA Sample Prep (Illumina ...
-
bioRxiv - Biochemistry 2020Quote: ... After proteolytic cleavage the protein was incubated with 1.5 g Protino Ni-IDA resin (Macherey-Nagel, Düren, Germany) for 25 min at 4°C to remove His6-SUMO (for purification of SUMO-Hsc70 overnight digestion with Ulp1 and second incubation with Protino Ni-IDA was omitted) ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were run on bis-acrylamide gels and then transferred to PVDF membranes (Macherey-Nagel, Düren, Germany) using a Trans-blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: Spike peptide-stimulated splenocytes split were used for RNA extraction by using the sNucleoSpin™ Kit Plus kit (Macherey-Nagel). cDNA was generated by using a high-capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... NucleoSpin® plasmid isolation kit and NucleoSpin® gel and PCR clean-up kit were purchased from Macherey-Nagel (Germany). PierceTM protease inhibitor tablets EDTA free and Pierce™ high capacity Ni-IMAC resin were purchased from Thermo Scientific (international) ...
-
bioRxiv - Bioengineering 2022Quote: ... purified using PCR clean-up kit (Macherey-Nagel), and transformed in electrocompetent E ...
-
bioRxiv - Synthetic Biology 2019Quote: ... or the NucleoBond Xtra Midi kit (Macherey-Nagel). Synthetic oligonucleotides were ordered from Sigma-Aldrich or Eurofins ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NucleoSpin Plant II kit (Macherey-Nagel).
-
bioRxiv - Bioengineering 2020Quote: ... NucleoSpin® Plasmid EasyPure Kit (Macherey-Nagel, Germany) was used for plasmid preparation ...
-
bioRxiv - Microbiology 2021Quote: ... or cells (NucleoSpin RNA plus kit, Macherey-Nagel) at different time post-electroporation (4 hpe – 7 dpe) ...
-
bioRxiv - Microbiology 2021Quote: ... using the NucleoSpin Plasmid Mini Kit (Macherey-Nagel) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... or the NucleoSpin Blood XL kit (Macherey-Nagel), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... produced using an endotoxin-free kit (Macherey-Nagel), were co-injected with the I-SceI meganuclease (Grabher et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NucleoSpin® RNA kit (Macherey-Nagel, #740955.250) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Genomics 2022Quote: ... The Nucleospin® Tissue kit (Macherey-Nagel, Germany) was used for bacterial DNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by NucleoSpin RNA kit (Macherey-Nagel). Then rRNA depletion was performed with the RiboMinus Eukaryote System v2 (Invitrogen–Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we used the Nucleospin Kit (Macherey-Nagel, USA) following manufacturer guidelines but with 60 µl instead of 100 µl of elution buffer added in the final step ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a NucleoSpin RNA extraction kit (Macherey-Nagel), treated with Turbo DNase (Ambion) ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... using the NucleoSpin RNA virus kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using the NucleoSpin RNA Plus kit (MACHEREY-NAGEL GmbH & Co ...
-
bioRxiv - Genomics 2022Quote: ... or the NucleoMagVet kit (Macherey-Nagel, Düren, Germany) on a KingFisher® extraction platform (Thermo-Fisher-Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Neuroscience 2023Quote: ... NucleoSpin RNA XS kit (Macherey-Nagel; Düren, Germany), or TRIzol Reagent with phenol-chloroform extraction (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Zoology 2023Quote: ... or the NucleoSpin® Tissue Kit (Macherey-Nagel). At least one specimen per site was sequenced for two standard markers ...
-
bioRxiv - Genomics 2022Quote: ... NucleoSpin miRNA Plasma Kit (NUC; Macherey-Nagel, 740981.50), QIAamp ccfDNA/RNA Kit (CCF ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using Nucleospin kit (Macherey-Nagel, Düren, Germany), and subcloned into pGEM-T plasmid ...