Labshake search
Citations for Macherey-Nagel GmbH :
101 - 150 of 762 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from six human fecal samples using the NucleoSpin® Microbial DNA Kit (Macherey-Nagel, Düren, Germany), as described previously [36] ...
-
bioRxiv - Microbiology 2020Quote: ... ChIP-DNA and input DNA were purified using the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel). The DNA concentration of the input DNA was determined using the Qubit dsDNA BR Assay Kit (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... difficile strains was estimated by quantitative PCR on genomic DNA extracted using the NucleoSpin Microbial DNA kit (Macherey-Nagel). The total chromosome copy number was quantified based on the reference gene dnaF (CD1305 ...
-
bioRxiv - Genomics 2023Quote: High-molecular-weight DNA was extracted by using Nu-cleoBond HMW DNA (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) in accordance with the following manufacturers’ protocols ...
-
bioRxiv - Genetics 2023Quote: ... except for genomic DNA for whole-genome sequencing that was extracted using NucleoSpin DNA purification kit (MACHEREY-NAGEL®).
-
bioRxiv - Plant Biology 2023Quote: ... DNA isolations were conducted using the NucleoSpin Plant II Mini Kit for DNA from plants (Macherey-Nagel, Düren, Germany). Preliminary quality assessments were conducted using agarose gel visualization and NanoDrop (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleaved protein was passed through Ni-TED (Macherey-Nagel) to remove uncleaved protein ...
-
bioRxiv - Biochemistry 2024Quote: All proteins were purified using Ni-IDA (Macherey-Nagel) following the instructions provided by the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from the rotten food waste with NucleoSpin DNA Stool kits (Macherey-Nagel GmbH & Co. KG, Düren, Germany) and quality checked by using a NanoDrop (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Biochemistry 2024Quote: ... pcDNA5/FRT-SUGCT and pOG44 plasmid DNA was purified by NucleoBond Xtra Midi Plus EF DNA purification Kit (Macherey-Nagel). Purified pOG44 and pcDNA5/FRT-SUGCT plasmids were co-transfected into Flp-In 293 cells at a 9:1 ratio by using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 200 mg of stool sample using a modified NucleoSpin® DNA Stool kit (Macherey-Nagel, Germany) via physical ...
-
bioRxiv - Genomics 2023Quote: ... high-molecular weight genomic DNA was extracted from the leaves of R511 using NucleoBond HMW DNA (MACHEREY-NAGEL, Dueren, Germany). Genomic DNA was prepared using the SMRTbell Express Template Prep Kit (PacBio ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted in triplicate for mixed cell suspensions using either NucleoMag® DNA/RNA Water (Macherey-Nagel, Hoerdt, France), i.e. ...
-
bioRxiv - Neuroscience 2024Quote: ... BAC DNA for pronuclear injection was prepared using the large construct DNA purification kit - NucleoBond® Xtra BAC (Macherey-Nagel), linearized with PI-SceI and purified over a home-made Sepharose CL4B column (Johansson et al. ...
-
bioRxiv - Microbiology 2022Quote: ... metagenomic DNA was purified on columns (Macherey-Nagel) after mechanical lysis by bead-beating ...
-
bioRxiv - Cancer Biology 2021Quote: ... for NucleoSpin® DNA FFPE XS (Macherey-Nagel) and QIAamp DNA Micro (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA fragments were purified using NucleoSpin (Macherey-Nagel) and diluted to 1/100 for input and to the half for immunoprecipitated fractions ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... DNA gel extraction kit from Macherey-Nagel (Germany), trizol reagent ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4°C and the supernatant was added to Ni-NTA columns and His-tagged proteins were purified according to the Protino Ni-TED protein purification kit (Macherey-Nagel, Düren, Germany).
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted by phenol-chloroform extraction followed by column clean-up using NucleoSpin® DNA Plant II kit (Macherey-Nagel). Clustering and DNA sequencing of wild-type ...
-
bioRxiv - Genetics 2021Quote: ... DNA from three female and three male fifth instar larvae was isolated individually using the NucleoSpin DNA Insect kit (Macherey-Nagel). We observed that the primers Masc_F1 and Masc_R1 targeting EkMasc and EkMascB consistently showed off-target amplification in female samples ...
-
bioRxiv - Neuroscience 2022Quote: ... Mature worms were frozen as whole at − 20°C and DNA was later extracted using NucleoSpin Tissue Mini kit for DNA from cells and tissue (Macherey-Nagel). PCR was performed with OneTaq Quick-Load 2x Master Mix with Standard Buffer (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... and used for DNA extraction using the NucleoSpin Plant midi DNA extraction kit following the manufacture’s protocol (Macherey-Nagel, Düren, Germany). The genomic DNA was quality controlled using a Qubit® 3.0 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from a male wild type blood sample (2 ml) was purified with the NucleoBand®HMW DNA Kit (Macherey-Nagel). To eliminate fragments below 40 kb the Short Read Elimination Kit XL (Circulomics ...
-
bioRxiv - Genomics 2020Quote: ... the genomic DNA from the edited cells was isolated after the transduction for eight days using a DNA isolation kit (NucleoSpinBlood - Macherey-Nagel). The target region for base editing was amplified using the respective primers (Sup Tables 2 and 3) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the total genomic DNA from plasmids was extracted from fresh transformed bacteria using a plasmid DNA Maxi Prep kit (Nucleobond XtraMaxi EF, Macherey-Nagel). Transgenic control GFP fluorescent marker expressing line (NB30 ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from only the 13C-acetate grown cultures that yielded enough DNA at 94 days of incubation using the NucleoSpin Microbial DNA kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The 0.22 µm membrane was used for bacterial DNA isolation using NucleoMag DNA/RNA Water Kit (MACHEREY-NAGEL Inc., Bethlehem, PA) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The cloned BAC DNA was extracted using NucleoBond Xtra BAC kit for large construct plasmid DNA (Macherey-Nagel, catalog number 740436.25). For library cloning ...
-
bioRxiv - Genetics 2024Quote: ... DNA was extracted from fresh leaves using the NucleoSpin Plant II Mini kit for DNA from plants (Macherey-Nagel, Duren, Germany) and sequenced using the HiSeq 4000 sequencing system (Illumina Inc. ...
-
bioRxiv - Immunology 2021Quote: ... total protein was isolated by NucleoSpin TriPrep kit (Macherey-Nagel) from 5×106 PMNs ...
-
bioRxiv - Zoology 2021Quote: ... standard DNA extraction was performed using the NucleoSpin™ Plant II DNA extraction kit (Macherey-Nagel GmbH and Co., Düren NRW, Germany). A reasonable number (usually 30–70 ...
-
bioRxiv - Genomics 2020Quote: ... Cleaved Histone-DNA complexes were isolated by centrifugation and DNA was extracted with a NucleoSpin PCR Clean-up kit (Macherey-Nagel, 740609).
-
bioRxiv - Microbiology 2020Quote: We extracted DNA from the biomass pellets stored at −20°C using a NucleoSpin® Microbial DNA Kit (Macherey-Nagel, Düren, Deutschland), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... O23 and d44a genomic DNA was extracted from liquid-cultured aerial hyphae using the NucleoBond high-molecular-weight DNA kit (MACHEREY-NAGEL, Germany). The genomic DNA was processed through the short-read eliminator kit XL (Circulomics) ...
-
bioRxiv - Plant Biology 2024Quote: ... DNA was extracted from 3 to 4 leaves of 45 days old plants with a genomic DNA extraction kit (Macherey-Nagel, England). The DNAs of these leaves were combined to sequence the methylome of each plant ...
-
Chromosome-level assembly of Cucumis sativus cv. ‘Tokiwa’ as a reference genome of Japanese cucumberbioRxiv - Genomics 2024Quote: ... We extracted genomic DNA from 3 g of young leaves using Nucleobond HMW DNA kit (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany). We basically followed the DNA extraction protocol provided by the manufacturer ...
-
bioRxiv - Genomics 2024Quote: ... DNA was extracted in duplicate from ∼1 g of young leaf tissue using the Nucleobond HMW DNA Extraction kit (Macherey-Nagel, Germany). HMW DNA purity and concentration was assessed by Nanodrop and Qubit ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from 200 mg of the frozen stool samples using a modified NucleoSpin® DNA Stool Kit (Macherey-Nagel, Germany) with physical ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted following using NucleoSpin columns (Macherey-Nagel) and eluted in 30 µL of NE buffer ...
-
bioRxiv - Genomics 2022Quote: ... the DNA was purified using NucleoSpin columns (Macherey-Nagel) and sequenced on a NextSeq 500 Illumina sequencer.
-
bioRxiv - Physiology 2020Quote: ... NucleoSpin Tissue DNA purification kit (Macherey-Nagel, Dueren, Germany) was used to extract total DNA from adipose tissue according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid DNA was purified by NucleoSpin column (Macherey-Nagel), then analysed on a 1% agarose gel containing RedSafe™ (Sigma-Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... the DNA was purified using NucleoSpin columns (Macherey-Nagel) and sequenced on a NextSeq 500 Illumina sequencer.
-
bioRxiv - Genomics 2021Quote: ... the DNA was purified using NucleoSpin columns (Macherey-Nagel) and sequenced on a NextSeq 500 Illumina sequencer.
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was extracted (Macherey-Nagel Nucleospin kit, Cat # 740609.250) and subcloned into pGEM-T vector (Promega) ...