Labshake search
Citations for Macherey-Nagel GmbH :
51 - 100 of 2250 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... NucleoSpin® Tissue kit (Macherey-Nagel, Germany) was used to process genomic DNA from 25 mg of brain tumour biopsies and from 0.5ml of PBMC samples from each patient ...
-
bioRxiv - Microbiology 2020Quote: ... NucleoSpin RNA extraction kit (Macherey-Nagel, #740955.50) was used following the manufacturer’s specifications ...
-
bioRxiv - Bioengineering 2022Quote: ... NucleoSpin® RNA purification kit (Macherey-Nagel), SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... and a Nucleospin RNA kit (Macherey-Nagel). rRNA was removed with the Ribo-Zero Gold rRNA Removal Kit (Illumina) ...
-
bioRxiv - Cell Biology 2021Quote: ... Mini kit for RNA purification (Macherey-Nagel). The purified mRNA was fragmented and primed with random hexamers ...
-
bioRxiv - Microbiology 2020Quote: ... and Nucleospin® RNA kit (Macherey-Nagel) according to the manufacturers’ protocol.
-
bioRxiv - Microbiology 2020Quote: The NucleoSpin RNA extraction kit (Macherey-Nagel) was used to isolate total intracellular RNA according to the manufacturer’s specification ...
-
bioRxiv - Genomics 2022Quote: ... using the Nucleospin virus kit (Macherey-Nagel). Purified DNA was subsequently used for PCR amplification with the following primers ...
-
bioRxiv - Biochemistry 2021Quote: ... Mini kit for plasmid DNA (Macherey-Nagel). To obtain linear DNA of the indicated length ...
-
bioRxiv - Genomics 2020Quote: ... or NucleoSpin Blood Kit (Macherey-Nagel, Germany). SV breakpoints were confirmed with Sanger Sequencing where possible ...
-
bioRxiv - Molecular Biology 2020Quote: ... NucleoBond Xtra Midi kit (Macherey-Nagel; 740412.50) was used.
-
bioRxiv - Microbiology 2021Quote: A NucleoBond Xtra midi kit (Macherey-Nagel) and a QIAamp DNA minikit (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... using the RNA-Plus kit (Macherey-Nagel), and libraries were prepared with 1μg of total RNA using the NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... NucleoSpin Plasmid EasyPure Kit (Macherey-Nagel, Germany) was used for plasmid preparation ...
-
bioRxiv - Plant Biology 2023Quote: The NucleoSpin RNA extraction kit (Macherey-Nagel) was used to extract total RNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... or NucleoSpin Tissue XS kit (Macherey-Nagel) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The nucleoSpin plasmid easypure Kit (Macherey-Nagel) was used for plasmid purification and expression cassettes were sequence verified ...
-
bioRxiv - Molecular Biology 2024Quote: ... the NucleoSpin Plasmid Mini kit (MACHEREY-NAGEL) was used for minipreparations ...
-
bioRxiv - Microbiology 2022Quote: ... or NucleoSpin RNA extraction kit (Macherey-Nagel) and used in quantitative reverse transcription PCR (RT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... a NucleoSpin Plant II kit (Macherey-Nagel) for the Seven-parent-MAGIC and NORFAB panels ...
-
bioRxiv - Biophysics 2023Quote: ... Mini kit for plasmid DNA (Macherey-Nagel). Correct mutation of the plasmids was verified by sequencing performed by MicroSynth GmbH Göttingen.
-
bioRxiv - Microbiology 2024Quote: ... DNA extraction kits (Macherey-Nagel GmbH & Co.), protein ladder and 1 Kb DNA ladder (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... and the NucleoSpin miRNA kit (Macherey-Nagel). Firstly ...
-
bioRxiv - Genetics 2024Quote: NucleoSpin RNA Plus Kits (MACHEREY-NAGEL, 740984.250) was used for total RNA extraction following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... A NucleoSpin RNA Plant Kit (Macherey-Nagel) was used to isolate the RNA from the samples ...
-
bioRxiv - Neuroscience 2024Quote: The NucleoSpin RNA extraction kit (Macherey-Nagel) was used to purify the RNA from the cells ...
-
bioRxiv - Bioengineering 2024Quote: ... the NucleoSpin Plasmid Mini kit (MACHEREY-NAGEL) was used for minipreparations ...
-
bioRxiv - Cancer Biology 2024Quote: The Nucleospin RNA/Protein Kit (Macherey-Nagel) was used to extract RNA and also proteins from siRNA validation experiments (Fig ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted using either the Qiagen RNeasy kit or the Macherey Nagel RNAplus kit (Macherey-Nagel, Düren, Germany). RNA-seq libraries were prepared using the TruSeq Stranded mRNA Sample Prep (Illumina ...
-
bioRxiv - Microbiology 2020Quote: Spike peptide-stimulated splenocytes split were used for RNA extraction by using the sNucleoSpin™ Kit Plus kit (Macherey-Nagel). cDNA was generated by using a high-capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... NucleoSpin® plasmid isolation kit and NucleoSpin® gel and PCR clean-up kit were purchased from Macherey-Nagel (Germany). PierceTM protease inhibitor tablets EDTA free and Pierce™ high capacity Ni-IMAC resin were purchased from Thermo Scientific (international) ...
-
bioRxiv - Bioengineering 2022Quote: ... purified using PCR clean-up kit (Macherey-Nagel), and transformed in electrocompetent E ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NucleoSpin Plant II kit (Macherey-Nagel).
-
bioRxiv - Bioengineering 2020Quote: ... NucleoSpin® Plasmid EasyPure Kit (Macherey-Nagel, Germany) was used for plasmid preparation ...
-
bioRxiv - Microbiology 2021Quote: ... or cells (NucleoSpin RNA plus kit, Macherey-Nagel) at different time post-electroporation (4 hpe – 7 dpe) ...
-
bioRxiv - Microbiology 2021Quote: ... using the NucleoSpin Plasmid Mini Kit (Macherey-Nagel) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... or the NucleoSpin Blood XL kit (Macherey-Nagel), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... produced using an endotoxin-free kit (Macherey-Nagel), were co-injected with the I-SceI meganuclease (Grabher et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NucleoSpin® RNA kit (Macherey-Nagel, #740955.250) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Genomics 2022Quote: ... The Nucleospin® Tissue kit (Macherey-Nagel, Germany) was used for bacterial DNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by NucleoSpin RNA kit (Macherey-Nagel). Then rRNA depletion was performed with the RiboMinus Eukaryote System v2 (Invitrogen–Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we used the Nucleospin Kit (Macherey-Nagel, USA) following manufacturer guidelines but with 60 µl instead of 100 µl of elution buffer added in the final step ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a NucleoSpin RNA extraction kit (Macherey-Nagel), treated with Turbo DNase (Ambion) ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Neuroscience 2023Quote: ... NucleoSpin RNA XS kit (Macherey-Nagel; Düren, Germany), or TRIzol Reagent with phenol-chloroform extraction (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Zoology 2023Quote: ... or the NucleoSpin® Tissue Kit (Macherey-Nagel). At least one specimen per site was sequenced for two standard markers ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.