Labshake search
Citations for Macherey-Nagel GmbH :
601 - 650 of 2222 citations for ssc mir 17 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by NucleoSpin RNA kit (Macherey-Nagel). Then rRNA depletion was performed with the RiboMinus Eukaryote System v2 (Invitrogen–Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we used the Nucleospin Kit (Macherey-Nagel, USA) following manufacturer guidelines but with 60 µl instead of 100 µl of elution buffer added in the final step ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a NucleoSpin RNA extraction kit (Macherey-Nagel), treated with Turbo DNase (Ambion) ...
-
bioRxiv - Genomics 2021Quote: ... Mini kit for DNA from blood (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... using the NucleoSpin RNA virus kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using the NucleoSpin RNA Plus kit (MACHEREY-NAGEL GmbH & Co ...
-
bioRxiv - Genomics 2022Quote: ... or the NucleoMagVet kit (Macherey-Nagel, Düren, Germany) on a KingFisher® extraction platform (Thermo-Fisher-Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... kit with NTB binding buffer (#740595.150, Macherey-Nagel) according to the manufacturer’s instructions and eluted in 30 µL.
-
bioRxiv - Neuroscience 2023Quote: ... NucleoSpin RNA XS kit (Macherey-Nagel; Düren, Germany), or TRIzol Reagent with phenol-chloroform extraction (Thermo-Fisher Scientific ...
-
bioRxiv - Zoology 2023Quote: ... or the NucleoSpin® Tissue Kit (Macherey-Nagel). At least one specimen per site was sequenced for two standard markers ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel). The sgRNA loci were amplified with an indexing 5′ primer (5′-aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacNNNNNN gcacaaaaggaaactcaccct ...
-
bioRxiv - Genomics 2022Quote: ... NucleoSpin miRNA Plasma Kit (NUC; Macherey-Nagel, 740981.50), QIAamp ccfDNA/RNA Kit (CCF ...
-
bioRxiv - Developmental Biology 2023Quote: ... and protein extraction kit (Macherey-Nagel, Allentown, PA) (gene expression studies ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using Nucleospin kit (Macherey-Nagel, Düren, Germany), and subcloned into pGEM-T plasmid ...
-
bioRxiv - Genomics 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) and treated by DNase-free RNase A followed by ethanol precipitation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmid kits were purchased from Macherey-Nagel. Precision Plus ProteinTM protein standard was provided by Biorad ...
-
bioRxiv - Neuroscience 2023Quote: ... Maxi kit for DNA from blood (Macherey-Nagel) or QIAamp® DNA Mini (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... using the NucleoSpin RNA purification kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmid preparation kits were purchased from Macherey-Nagel.
-
bioRxiv - Cell Biology 2023Quote: ... or NucleoBond Xtra Midi EF kit (MACHEREY-NAGEL).
-
bioRxiv - Microbiology 2024Quote: ... RNA extraction (Macherey-Nagel RNA extraction kit; Germany) was done according to supplier instructions ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA of seedlings was extracted using either the innuPREP Plant RNA kit (analytic-jena) or the NucleoSpin RNA Plant kit (Macherey-Nagel). If necessary ...
-
bioRxiv - Genetics 2021Quote: ... The lysates were then purified to genomic DNA and RNA using NucleoSpin Tissue Kits and NucleoSpin RNA Plus kits (MACHEREY-NAGEL), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from single legs of individual mosquitoes or whole individual mosquitoes using NucleoSpin DNA Insect Kit (Machery-Nagel) or NucleoSpin Tissue Kit (Macherey-Nagel) following the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... In the following steps each amplicon generated either by PCR amplification or vector digestion was isolated and extracted from a 1% agarose gel through the NucleoSpin Gel (Macherey-Nagel) and PCR Clean-Up Kit (Takara ...
-
bioRxiv - Immunology 2020Quote: ... and eGFP were amplified with the following primers and appropriate sized fragments were isolated from agarose gels with the PCR clean-up Gel extraction (Macherey-Nagel). PCR fragments were mixed and a consecutive PCR was done with the CD200R-F and GFP-R primers before digestion with PmlI and NotI and ligation into pMX ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the reverse primer 5’AACCCAGGTAATGAACACAGTTTCTAT. PCR products were run on a gel (supplemental Fig. 2B) and bands were gel purified (Macherey-Nagel), inserted in a pCR-bluntII-Topo vector (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: PCR products were pooled by 6 to 12 according to the linkers and cleaned using the Nucleospin Gel and PCR clean up (Macherey-Nagel). Samples containing asymptomatic plants were pooled separately from those containing symptomatic leaves to limit potential cross-contaminations of highly concentrated viruses in symptomatic pools ...
-
bioRxiv - Molecular Biology 2023Quote: ... pX458 plasmid was digested with BpiI (BbsI; Thermo, #ER1011) and gel-purified by NucleoSpin Gel and PCR Clean-up (Macherey-Nagel); gRNA oligonucleotides were ligated into pX458 plasmid with T4 DNA ligase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... dissolved in TE buffer (10 mM Tris pH8, 1 mM EDTA pH8) and purified using NucleoSpin Gel and PCR clean-up (Macherey-Nagel). DNA was loaded on a 2% agarose gel ...
-
bioRxiv - Genomics 2024Quote: ... Cross-linking was reversed by overnight incubation at 65°C and DNA fragments were purified using NucleoSpin Gel and PCR Clean-up columns (Macherey-Nagel).
-
bioRxiv - Neuroscience 2023Quote: ... mRNA from CD11B+ cells was extracted using an RNA XS Plus extraction kit and that from brains using a NucleoSpin RNA extraction kit according to the manufacturers’ protocol (Macherey-Nagel®). Reverse transcription was performed using 350 ng (CD11B+ ...
-
A randomized multiplex CRISPRi-Seq approach for the identification of critical combinations of genesbioRxiv - Genetics 2023Quote: ... bacteria from the cultures used for infection were immediately pelleted by centrifugation and resuspended in 8 mL of RES-EF of the NucleoBond Xtra Midi EF kit prior to proceeding with the standard kit protocol (Macherey-Nagel 740420.50). Precipitated vectors were resuspended in 120 µL of water.
-
bioRxiv - Microbiology 2020Quote: ... coli using NucleoSpin Plasmid Kit (Macherey-Nagel, Düren, Germany). Deletion of the degU ...
-
bioRxiv - Evolutionary Biology 2021Quote: We used NucleoSpin Tissue kits (Macherey-Nagel, Düren, Germany) to extract and purify genomic DNA from the hind femur of each individual ...
-
bioRxiv - Developmental Biology 2020Quote: ... using NucleoSpin® RNA kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: For tissue extraction the RNA purification Kit (Macherey-Nagel) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a NucleoSpin RNA isolation kit (Macherey-Nagel, Germany). Hundreds of worms were collected for each experiment ...
-
bioRxiv - Molecular Biology 2019Quote: RNA was isolated with Nucleospin RNA kit (Macherey-Nagel) with DNase I treatment ...
-
bioRxiv - Microbiology 2020Quote: ... the NucleoSpin® Plasmid kit (Macherey-Nagel, Düren, Germany) was used ...
-
bioRxiv - Genomics 2021Quote: ... using the NucleoSpin Plasmid EasyPure kit #740727250 (Macherey-Nagel), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Fragments were gel purified (following kit instructions, Macherey-Nagel) and 30 ng of insert and 10 ng of vector ligated using 6U of T4 DNA ligase (Thermo ...
-
bioRxiv - Neuroscience 2020Quote: ... and NucleoBond Xtra Midi EF Kit (Macherey-Nagel, 740420.10) and verified them via Sanger sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... or NucleoSpin Tissue kit (routine genotyping; Macherey-Nagel #740952.25). OneTaq DNA polymerase (New England BioLabs #M0480 ...
-
bioRxiv - Microbiology 2021Quote: ... ljungdahlii with the NucleoSpin Tissue Mini kit (Macherey-Nagel) and used as PCR-template ...
-
bioRxiv - Microbiology 2022Quote: ... NucleoSpin RNA virus kit (Macherey-Nagel; cat no. 740956.250) was used for RNA extraction.
-
bioRxiv - Cancer Biology 2022Quote: ... RNA Isolation Kit according to manufacturer’s instructions (Macherey-Nagel). RNA concentrations were measured with Nanodrop ...
-
bioRxiv - Microbiology 2021Quote: ... Mini kit for RNA purification (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted (Nucleospin RNA kit, Macherey-Nagel, 740955). The remaining part of embryos were processed for whole-mount in situ hybridisation detection of Uncx4.1 and accurate somite count determination.
-
bioRxiv - Molecular Biology 2020Quote: ... coli cultures using NucleoBond Plasmid MAXI KIT (Macherey-Nagel) and resuspended in TE buffer ...