Labshake search
Citations for Applied Biological Materials :
1 - 50 of 103 citations for ssc mir 432 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... or Zip-21 (LentimiRa-GFP-has-miR-21-5p vector, Applied Biological Materials #mh10276). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: Real-time PCR was performed for miR-21-5p in A2780R cells infected with lentivirus from Zip control (pLenti-III-miR-GFP control vector from Applied Biological Materials #m001) or Zip-21 (LentimiRa-GFP-has-miR-21-5p vector ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Cell Biology 2020Quote: ... and pLenti-III-miR-GFP Control Vector (Cat: M001, Applied Biological Materials) were purified using the EndoFree Plasmid Maxi Prep Kit (Cat ...
-
bioRxiv - Immunology 2022Quote: ... One quarter of the total RNA sample was used as template for OneStep RT-PCR (ABM) using the following primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... hsa-miR-203a miRNA mimic (MIMAT0000264) and antagomir (MIMAT0031890) were obtained from ABM.
-
bioRxiv - Cell Biology 2020Quote: ... the LentimiRa-GFP-hsa-miR-494-3p Vector (Cat: mh10739, Applied Biological Materials, abmgood.com) and pLenti-III-miR-GFP Control Vector (Cat ...
-
bioRxiv - Systems Biology 2022Quote: ... Commercially available sgRNAs sets were purchased from Applied Biological Materials (catalog numbers ...
-
bioRxiv - Systems Biology 2021Quote: ... This process (20 sets of initial guesses × 10 ABM runs × 100 generations) was repeated 30 times ...
-
bioRxiv - Immunology 2023Quote: ... or ABM All-in-one RT kit (ABM) was used to synthesize cDNA according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Reverse transcription was performed to generate cDNA using 5X All-In-One RT MasterMix (with AccuRT Ge5X All-In-One RT MasterMix and AccuRT Genomic DNA Removal Kit) (Applied Biological Materials) for RT–qPCR ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was obtained using RT MasterMix (Applied Biological Materials) and used to perform a SYBR-based real-time PCR (BioLine ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was then generated using the 5X RT Mastermix (ABM, Vancouver, Canada). Gene expression to validate RNA-seq analysis was quantified by qRT-PCR using BrightGreen 2X qPCR MasterMix (ABM ...
-
bioRxiv - Physiology 2023Quote: ... RNA samples underwent reverse transcription (All-in-one RT Master Mix – ABM). qPCR was performed with BrightGreen Express reagent (ABM ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were transfected with a Hsp47-set of four siRNA lentivectors (rat) (Applied Biological Materials, catalog #: 435050960395), or scrambled siRNA GFP lentivector (Applied Biological Materials ...
-
bioRxiv - Microbiology 2019Quote: ... Total cDNA was synthesized using the All-In-One RT Master Mix (ABM). For RT-qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse transcription was performed using All-in-One 5X RT MasterMix (ABM, G592). Primer Express 3.0 software was used to design primers and qRT-PCR was performed as previously described (83,84 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was then synthesized using All-In-One RT MasterMix (Applied Biological Materials). qPCR was carried out using TB Green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was carried out using ‘5× All-in-one RT Mastermix’ (#g486; ABM), following the manufacturer instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Lentiviruses were produced from sets of four mouse piLenti-siRNA-GFP lentiviral vectors (Applied Biological Materials, Inc. Richmond, BC, Canada) targeting Pelp1 (cat no ...
-
bioRxiv - Microbiology 2019Quote: ... staining or PCR (G238, ABM).
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green PCR kit(Applied Biological Materials, ABM) and a Rotor-Gene-Q instrument (QIAGEN) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green PCR kit(Applied Biological Materials, ABM) and a Rotor-Gene-Q instrument (QIAGEN) ...
-
bioRxiv - Cell Biology 2024Quote: PCR-based mycoplasma detection was performed using the Mycoplasma PCR detection kit (Applied Biological Materials) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... EEO media was defined as the minimal set of components needed to establish organoid cultures expansion and was composed of advanced basal media cocktail10 (ABM, 1X); rhEGF (50 ng/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... Scrambled siRNA GFP lentivector (catalog #: LV015-G) and Hsp47-set of four siRNA lentivectors (rat) (catalog #: 435050960395) were obtained from Applied Biological Materials. psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Genomics 2020Quote: ... the First-strand cDNA was synthesized using a 5X All-In-One RT MasterMix (ABM, Canada). The relative quantification was done by ChamQTM Universal SYBR® qPCR Master Mix (Vazyme ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized by reverse transcription using All-In-One 5X RT Master Mix (ABM-G592) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by preparation of cDNA using 5× All-In- One RT MasterMix (Applied Biological Materials Inc.) as per the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... The viral titer was determined by RT‒qPCR using the titer kit from Applied Biological Materials prior to use.
-
bioRxiv - Genetics 2021Quote: ... Reverse transcription was performed using the ABM all-in-one 5X RT Mastermix kit (ABM, Richmond, Canada). Primer Express 3.0 software was used for designing primers and quantitative real-time polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Immunology 2021Quote: ... Some 500 ng of RNA were reverse transcribed using the ABM 5X RT MasterMix (Applied Biological Materials), as directed by the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed into first-strand cDNA using All-in-one RT MasterMix (Applied Biological Materials). qPCR of cDNA was then performed using P7/P8 primers (5249-5358) ...
-
bioRxiv - Plant Biology 2022Quote: ... before reverse transcription to cDNA using a 5×All-In-One RT MasterMix (Applied Biological Materials Inc.). PhnsLTP1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized from total RNA by using 5×All-In-One RT MasterMix (ABM, China) following the standard protocols ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription to generate cDNA was performed using the ABM All-In-One 5X RT MasterMix (ABM). Primer Express 3.0 software was used for designing primers for gene expression analysis by quantitative real-time polymerase chain reaction (Table S4) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reaction mixtures (25 μl) consisted of 12.5 μl of MegaFi Fidelity 2X PCR MasterMix (ABM Inc., Richmond, Canada), 1.5 μl of each primer (final concentration 0.6 μM) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were tested for mycoplasma using PCR-based screening (PCR Mycoplasma Detection Kit, Cat# G238, Applied Biological Materials Inc.) weekly or biweekly.
-
bioRxiv - Cell Biology 2022Quote: ... RNA was converted into cDNA using 5x ALL-In-One RT Master Mix (Applied Biological Materials Inc, G490) following the manufacturers’ instructions and diluted 20 times with nuclease-free H2O ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was prepared by reverse transcription with All-in-One 5X RT MasterMix (G592, Applied Biological Materials Inc) with 1000ng RNA ...
-
bioRxiv - Cell Biology 2019Quote: ... tested routinely by PCR (Applied Biological Materials, Canada) and ...
-
bioRxiv - Microbiology 2022Quote: ... 1X Bestaq PCR buffer (Applied Biological Materials Inc.), dNTP mix containing 200 mM concentrations of each nucleotide (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ng of DNase-treated RNA was converted into cDNA using Oligo-dT primers in a reaction volume of 10 μl using the OneScript Plus cDNA synthesis kit (Catalog no. G236; ABM). The cDNA was amplified using primer pairs specific to Tat ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the PCR mycoplasma detection kit (ABM, Cat. G238).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from the isolated RNA by reverse transcription using RevertAid™ first strand cDNA synthesis kit (5× All-In-One RT MasterMix, ABM) according to the manufacturer’s instructions in a RNase-free environment ...
-
PI3K/HSCB axis facilitates FOG1 nuclear translocation to promote erythropoiesis and megakaryopoiesisbioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from erythroid/megakaryocytic progenitor or K562 cells using the RNA Isolation Kit (Omn-02, Omiget, China) and reverse-transcribed into cDNA with the All-In-One 5X RT MasterMix (G592, ABM, Canada). For qRT-PCR ...
-
PI3K/HSCB axis facilitates FOG1 nuclear translocation to promote erythropoiesis and megakaryopoiesisbioRxiv - Molecular Biology 2024Quote: ... the 20-μL reaction systems were established with the cDNA samples and the gene-specific primers listed in Table S2 based on the BlasTaq™ 2X qPCR MasterMix (G891, ABM, Canada). All reactions were performed on the QuantStudio™ 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Cancer Biology 2021Quote: ... The mRNA and miRNA reverse transcription were performed within a 5×All-In-One RT MasterMix kit (Applied Biological Materials, BC, Canada) and TaqMan microRNA Reverse Transcription Kit (Thermo Fisher ...