Labshake search
Citations for Applied Biological Materials :
1 - 50 of 103 citations for Rat Aflatoxin B1 Aldehyde Reductase Member 3 AKR7A3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... pilenti-SPINK1-shRNA-GFP-Puro construct(rat) from Applied Biological Materials(abm), Nanjing.
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were transfected with a Hsp47-set of four siRNA lentivectors (rat) (Applied Biological Materials, catalog #: 435050960395), or scrambled siRNA GFP lentivector (Applied Biological Materials ...
-
bioRxiv - Cell Biology 2022Quote: ... Scrambled siRNA GFP lentivector (catalog #: LV015-G) and Hsp47-set of four siRNA lentivectors (rat) (catalog #: 435050960395) were obtained from Applied Biological Materials. psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Cancer Biology 2021Quote: ... and titered using lentivirus qPCR titer kit (ABM). 1963B and BT20 cells were transduced with the virus at an MOI of 10 following puromycin selection (2 ug/ml ...
-
bioRxiv - Immunology 2023Quote: ... or ABM All-in-one RT kit (ABM) was used to synthesize cDNA according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... and cDNA generated (OneScript Hot cDNA Synthesis Kit, ABM) based on manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the PCR mycoplasma detection kit (ABM, Cat. G238).
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... carried out with OneScript® Plus cDNA Synthesis Kit (ABM), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The OneScript Reverse Transcriptase cDNA Synthesis kit by Applied Biological Materials Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral particles were tittered via qPCR (ABM qPCR Lentivirus Titration Kit) before storage at −80°C.
-
bioRxiv - Genomics 2023Quote: ... Viral titers were assessed with a qPCR Lentivirus Titration Kit (ABM) and functional titers were assessed by transducing iPSC-derived NPCs with serial dilutions of virus and quantifying BFP fluorescence intensity and RNase H1 protein levels by Western Blot.
-
bioRxiv - Cancer Biology 2022Quote: ... and confirmed mycoplasma free using a PCR detection kit (ABM G238). Recombination of the LSL-Nras allele was verified by PCR using the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc., Richmond, BC, Canada). Viral titers were 1.425 x 109 GC/mL for lacZ sgRNA control ...
-
bioRxiv - Cancer Biology 2021Quote: ... High Titer cell immortalization kit (Applied Biological Materials, cat. no. LV613; www.abmgood.com), per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Lentiviral shRNA particles were titered using the qPCR Lentiviral Titration Kit (ABM). shRNA particles were transduced into 12Z cells at a 100-fold multiplicity of infection ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR were run using a Taq DNA polymerases Kit (ABM, Richmond, B.C) and a thermal cycler (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: miRNA All-In-One cDNA Synthesis Kit (Applied Biological Materials, Richmond, BC, Canada) was used to convert RNA to generate ...
-
bioRxiv - Cell Biology 2022Quote: ... Mycoplasma testing was conducted monthly using a mycoplasma PCR detection kit (ABM, G238). Human and mouse cell lines were authenticated by STR profiling (Almeida et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Genomes were quantified using a qPCR Lentivirus Titer Kit (Applied Biological Materials, LC900) as per the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... carried out with the OneScript® Plus cDNA Synthesis Kit (ABM, Richmond, Canada). For amplification of the full HhTAR1 open reading frame (ORF) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral titers were determined using the qPCR Lentivirus Titration Kit (Applied Biological Materials), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... and tittered by qPCR Lentivirus Titration Kit (Applied Biological Materials Inc., LV900-S). bEnd.3 cells were plated in 6-well plates and allowed to adhere overnight ...
-
bioRxiv - Genomics 2022Quote: ... The cells were tested for Mycoplasma contamination with the PCR detection kit (ABM) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral titers were determined using the qPCR Lentivirus Titration Kit (Applied Biological Materials), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Lentivirus was titered using the qPCR Lentivirus Titration Kit (Applied Biological Materials LV900).
-
bioRxiv - Cancer Biology 2021Quote: ... Cultures were regularly checked for mycoplasma contamination utilizing a PCR detection kit (G238, ABM) or Hoechst staining ...
-
bioRxiv - Cell Biology 2022Quote: ... lentiviral particles were titrated using the qPCR lentivirus titration kit (Applied Biological Materials Inc.) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... cultures were screened for various Mycoplasma strains using the PCR Mycoplasma detection kit (ABM) and confirmed negative before being used for experimental assays ...
-
bioRxiv - Cancer Biology 2023Quote: ... cultures were screened for various Mycoplasma strains using the PCR Mycoplasma detection kit (ABM) and confirmed negative before being used for experimental assays ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green PCR kit(Applied Biological Materials, ABM) and a Rotor-Gene-Q instrument (QIAGEN) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green PCR kit(Applied Biological Materials, ABM) and a Rotor-Gene-Q instrument (QIAGEN) ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral titer was determined with an ABM qPCR Lentivirus Titration Kit (ABM, Vancouver, B.C., Canada). Titers were 106-107 infectious particles/mL.
-
bioRxiv - Cancer Biology 2020Quote: ... and the absence of mycoplasma was confirmed using Mycoplasma PCR detection kit (Applied Biological Materials).
-
bioRxiv - Cell Biology 2021Quote: ... Lentivirus titers were measured by using the qPCR Lentivirus Titer Kit (Applied Biological Materials, China).
-
bioRxiv - Neuroscience 2022Quote: ... The titer was determined using the qPCR Adeno-Associated Virus Titration kit (Applied Biological Materials) and the purity was verified by SDS-PAGE and total protein staining using instant blue reagent (Expedeon) ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentivirus was quantified with the qPCR lentivirus titration kit (Applied Biological Materials, catalog #: LV900), and stored at −80°C.
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined using a qPCR Lentivirus Titration Kit (#LV900, Applied Biological Materials). For lentiviral transduction ...
-
bioRxiv - Immunology 2023Quote: ... The titer was determined using the qPCR Adeno-Associated Virus Titration kit (Applied Biological Materials) and the purity was verified by SDS–PAGE and total protein staining using InstantBlue reagent (Expedeon).
-
bioRxiv - Microbiology 2024Quote: ... Cells were monitored routinely for mycoplasma contamination using a mycoplasma detection PCR kit (ABM, G238). A FLAG (NiV-F-FLAG ...
-
bioRxiv - Cell Biology 2024Quote: PCR-based mycoplasma detection was performed using the Mycoplasma PCR detection kit (Applied Biological Materials) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested for mycoplasma contamination (PCR Mycoplasma Detection Kit, Applied Biological Materials, G238) and were found to be negative ...
-
bioRxiv - Microbiology 2021Quote: ... free by testing using the ABM Mycoplasma PCR Detection Kit (G238, Applied Biological Materials Inc., Canada).
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral titers were obtained using ABMgood qPCR Lentivirus Titer Kit (Applied Biological Materials, Cat. no. LV900). All vectors were confirmed by restriction digest and Sanger sequencing ...