Labshake search
Citations for Applied Biological Materials :
1 - 50 of 120 citations for Mouse 14 3 3 protein sigma SFN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Neuroscience 2021Quote: The first cohort consisted of 14 participants that dynamically switched between a 2-back working memory (WM) task and an autobiographical memory (ABM) retrieval task ...
-
bioRxiv - Biochemistry 2024Quote: ... or mouse anti-α-tubulin (ABM # G094) at 1:8000 for a loading control ...
-
bioRxiv - Molecular Biology 2020Quote: ... and dCas9 recombinant protein (Applied Biological Materials Inc.). After 10 minutes at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GAPDH (1:1000; Applied Biological Materials), mouse anti-GFP (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (1:1000, Applied Biological Materials) and with rabbit or mouse-peroxidase secondary antibodies (1:10,000 ...
-
bioRxiv - Immunology 2021Quote: ... Immortalized mouse dendritic cells (MutuDC1940, Applied Biological Materials Inc. #T0528) were cultured in Iscove’s DMEM medium supplemented with 10% fetal calf serum ...
-
bioRxiv - Microbiology 2023Quote: ... and co-transfected with recombinant saCas9 Nuclease NLS Protein (Applied Biological Materials Inc.), and a PCR-based puromycin resistance construct containing 5’- and 3’-UTRs of the targeted gene ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-ß-actin mouse monoclonal antibody (Applied Biological Materials, Richmond, BC, Canada; #G043), anti-EEA1 mouse monoclonal antibody (BD Biosciences ...
-
bioRxiv - Physiology 2023Quote: Human VSMCs and mouse VSMCs were purchased from Applied Biological Materials (T0515, Richmond, Canada) and American Type Culture Collection (ATCC) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the mouse Ehd1 lentiviral vector (pLenti-GIII-CMV-RFP-2A-Puro) (#190510640495; Applied Biological Materials) was stably transduced into TC71-EHD1-KO ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were incubated with 1μg/mL of mouse anti-Flag (Applied Biological Materials Inc., Richmond, BC, Canada), 0.25 μg/mL of rabbit anti-SARS-CoV-2-Nsp1 (Genetex ...
-
bioRxiv - Cancer Biology 2021Quote: ... and titered using lentivirus qPCR titer kit (ABM). 1963B and BT20 cells were transduced with the virus at an MOI of 10 following puromycin selection (2 ug/ml ...
-
bioRxiv - Immunology 2023Quote: ... or ABM All-in-one RT kit (ABM) was used to synthesize cDNA according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: Adeno-associated virus serotype 8 expressing mouse Aig1 and AAV8-GFP control were purchased from Applied Biological Materials (Canada). AAV injection was carried out as previously described57 ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies (company, cat no.) were used in Western blot experiments: mouse anti-beta-actin (ABM, #G043), mouse anti-Flag (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... and cDNA generated (OneScript Hot cDNA Synthesis Kit, ABM) based on manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the PCR mycoplasma detection kit (ABM, Cat. G238).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Lentiviruses were produced from sets of four mouse piLenti-siRNA-GFP lentiviral vectors (Applied Biological Materials, Inc. Richmond, BC, Canada) targeting Pelp1 (cat no ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse St8sia1 sgRNA CRISPR/Cas9 All-in-One Lentivector (pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro; #456551140595, Applied Biological Materials) with three target sequences Target 1-17 ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... carried out with OneScript® Plus cDNA Synthesis Kit (ABM), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Flag (G191 ABM and F7425 Sigma), GFP (A6455 Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Flag (G191 ABM and F7425 Sigma), GAPDH (14C10 Cell Signaling) ...
-
bioRxiv - Cancer Biology 2022Quote: ... was from Addgene (#27704). Lentiviral Mouse EHD2 vector (pLenti-GIII-CMV-GFP-2A-puro, cat. # 190520640395) was from Applied Biological Materials (Richmond, BC, Canada). Luciferase/tdTomatao reporter was engineered using the MuLE system kit from Addgene (Cat ...
-
bioRxiv - Cancer Biology 2023Quote: All-in-one lentiviral vectors encoding both the RNA guide (gRNA) and the Cas9 protein for AR gene deletion were obtained from Applied Biological Materials Inc ...
-
bioRxiv - Microbiology 2020Quote: The OneScript Reverse Transcriptase cDNA Synthesis kit by Applied Biological Materials Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral particles were tittered via qPCR (ABM qPCR Lentivirus Titration Kit) before storage at −80°C.
-
bioRxiv - Genomics 2023Quote: ... Viral titers were assessed with a qPCR Lentivirus Titration Kit (ABM) and functional titers were assessed by transducing iPSC-derived NPCs with serial dilutions of virus and quantifying BFP fluorescence intensity and RNase H1 protein levels by Western Blot.
-
bioRxiv - Cancer Biology 2022Quote: ... and confirmed mycoplasma free using a PCR detection kit (ABM G238). Recombination of the LSL-Nras allele was verified by PCR using the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: PAEC were transduced with adenoviral constructs encoding a constitutive active mutant of dual specificity mitogen-activated protein kinase 5 (caMEK5) (#000101A, Applied Biological Materials Inc); Flag-tagged KLF4 (#VH829440 ...
-
bioRxiv - Neuroscience 2020Quote: ... or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc., Richmond, BC, Canada). Viral titers were 1.425 x 109 GC/mL for lacZ sgRNA control ...
-
bioRxiv - Cancer Biology 2021Quote: ... High Titer cell immortalization kit (Applied Biological Materials, cat. no. LV613; www.abmgood.com), per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Lentiviral shRNA particles were titered using the qPCR Lentiviral Titration Kit (ABM). shRNA particles were transduced into 12Z cells at a 100-fold multiplicity of infection ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR were run using a Taq DNA polymerases Kit (ABM, Richmond, B.C) and a thermal cycler (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: miRNA All-In-One cDNA Synthesis Kit (Applied Biological Materials, Richmond, BC, Canada) was used to convert RNA to generate ...
-
bioRxiv - Cell Biology 2022Quote: ... Mycoplasma testing was conducted monthly using a mycoplasma PCR detection kit (ABM, G238). Human and mouse cell lines were authenticated by STR profiling (Almeida et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Genomes were quantified using a qPCR Lentivirus Titer Kit (Applied Biological Materials, LC900) as per the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... carried out with the OneScript® Plus cDNA Synthesis Kit (ABM, Richmond, Canada). For amplification of the full HhTAR1 open reading frame (ORF) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral titers were determined using the qPCR Lentivirus Titration Kit (Applied Biological Materials), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... and tittered by qPCR Lentivirus Titration Kit (Applied Biological Materials Inc., LV900-S). bEnd.3 cells were plated in 6-well plates and allowed to adhere overnight ...
-
bioRxiv - Genomics 2022Quote: ... The cells were tested for Mycoplasma contamination with the PCR detection kit (ABM) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral titers were determined using the qPCR Lentivirus Titration Kit (Applied Biological Materials), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Lentivirus was titered using the qPCR Lentivirus Titration Kit (Applied Biological Materials LV900).
-
bioRxiv - Cancer Biology 2021Quote: ... Cultures were regularly checked for mycoplasma contamination utilizing a PCR detection kit (G238, ABM) or Hoechst staining ...