Labshake search
Citations for Applied Biological Materials :
1 - 50 of 100 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: alpha-synuclein-HA-tag adenovirus were obtained from Applied Biological Materials Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral particles were tittered via qPCR (ABM qPCR Lentivirus Titration Kit) before storage at −80°C.
-
bioRxiv - Molecular Biology 2020Quote: ... Subsequent qPCR analysis was performed with BrightGreen 2x qPCR Master mix (Applied Biological Materials Inc.) on a Bio-Rad 1000 Series Thermal Cycling CFX96 Optical Reaction module ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Cancer Biology 2021Quote: ... and titered using lentivirus qPCR titer kit (ABM). 1963B and BT20 cells were transduced with the virus at an MOI of 10 following puromycin selection (2 ug/ml ...
-
bioRxiv - Physiology 2023Quote: ... qPCR was performed with BrightGreen Express reagent (ABM) and run on the CFX384 Real-Time PCR system for 40 cycles ...
-
bioRxiv - Cancer Biology 2024Quote: ... using BlasTaq™ 2X qPCR MasterMix (ABM, G891) and cDNA was diluted to 1:40 ...
-
bioRxiv - Cell Biology 2024Quote: The levels of mRNA were measured by real-time qPCR using BlasTaq 2×qPCR master mix (Applied Biological Materials, Richmond, BC, Canada) with gene-specific primers (Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... BlasTaq 2X qPCR MasterMix (G891, Applied Biological Materials Inc) and ABI Step One system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2020Quote: ... Evagreen 2X qPCR MasterMix was purchased from Applied Biological Materials Inc ...
-
bioRxiv - Genomics 2023Quote: ... Viral titers were assessed with a qPCR Lentivirus Titration Kit (ABM) and functional titers were assessed by transducing iPSC-derived NPCs with serial dilutions of virus and quantifying BFP fluorescence intensity and RNase H1 protein levels by Western Blot.
-
bioRxiv - Cell Biology 2024Quote: ... gel electrophoresis using 1X tris–borate–EDTA buffer alongside a 100 base pair ladder using SafeView™ Classic (Applied Biological Materials, Cat No. G108) nucleic acid stain and Gel Loading Dye ...
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant EGF (20 ng/mL; ABM), and human recombinant bFGF-2 (10ng/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc., Richmond, BC, Canada). Viral titers were 1.425 x 109 GC/mL for lacZ sgRNA control ...
-
bioRxiv - Genetics 2022Quote: ... Lentiviral shRNA particles were titered using the qPCR Lentiviral Titration Kit (ABM). shRNA particles were transduced into 12Z cells at a 100-fold multiplicity of infection ...
-
bioRxiv - Physiology 2023Quote: ... utilizing BrightGreen Express 2x qPCR MasterMix - iCycler (ABM; cat no. MasterMix-EC). Products were amplified at 95°C for 3 minutes followed by cycles of 95°C for 15s ...
-
bioRxiv - Plant Biology 2023Quote: ... in combination with the EvaGreen 2x qPCR MasterMix - iCycler (Applied Biological Materials). The primers used to detect the transcripts are listed in Table S1 ...
-
bioRxiv - Genetics 2024Quote: ... Viral titers were assessed by qPCR Lenti/Retrovirus Titer Kits (ABM, Canada).
-
bioRxiv - Cancer Biology 2022Quote: ... Human HC cells immortalized by human telomerase reverse transcriptase (hTERT) expression were purchased from Applied Biological Materials (cat. no. T0570). The cell lines used were not further authenticated ...
-
bioRxiv - Immunology 2021Quote: ... Complementary DNA was generated by qPCR using BrightGreen SYBR Green (Applied Biological Materials). Cq values obtained on a CFX96 PCR System (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... Genomes were quantified using a qPCR Lentivirus Titer Kit (Applied Biological Materials, LC900) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral titers were determined using the qPCR Lentivirus Titration Kit (Applied Biological Materials), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral titers were determined using the qPCR Lentivirus Titration Kit (Applied Biological Materials), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Lentivirus was titered using the qPCR Lentivirus Titration Kit (Applied Biological Materials LV900).
-
bioRxiv - Immunology 2024Quote: ... BlasTaq™ 2X qPCR MasterMix (ref. G892-1, Applied Biological Materials, Vancouver, Canada) and specific primers were used to assess gene transcripts expression for following targets ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). DMEM-F12 w/o L-Glutamine w/o Hepes w/o Glucose (Biowest ...
-
bioRxiv - Genetics 2020Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). Cells were monitored for mycoplasma contamination using MycoAlert (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... lentiviral particles were titrated using the qPCR lentivirus titration kit (Applied Biological Materials Inc.) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... which was carried out using the BlasTaq 2X qPCR Mater Mix (ABM, Richmond, Canada) in an Light Cycler 86 apparatus (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... The titer of virus was measured using the qPCR Retrovirus Titer Kit (ABM, G949). If the titer was less than 2×106 IU/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human colonic cells (hCC; T0570, Applied biological materials, Inc.) were cultured in DMEM supplemented with 10% FBS in 5% CO2/air humidified atmosphere at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... and human endometrial stromal cells (hESCs; T0533 ABM, Canada) were utilized in this study ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral titer was determined with an ABM qPCR Lentivirus Titration Kit (ABM, Vancouver, B.C., Canada). Titers were 106-107 infectious particles/mL.
-
bioRxiv - Molecular Biology 2020Quote: ... CA).19 Polymerase Chain Reaction was performed using qPCR master-mix (Applied Biological Materials Inc., Canada). The primer sequences are listed in Table 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentivirus titers were measured by using the qPCR Lentivirus Titer Kit (Applied Biological Materials, China).
-
bioRxiv - Immunology 2023Quote: ... The titer was determined using the qPCR Adeno-Associated Virus Titration kit (Applied Biological Materials) and the purity was verified by SDS–PAGE and total protein staining using InstantBlue reagent (Expedeon).
-
bioRxiv - Neuroscience 2022Quote: ... The titer was determined using the qPCR Adeno-Associated Virus Titration kit (Applied Biological Materials) and the purity was verified by SDS-PAGE and total protein staining using instant blue reagent (Expedeon) ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentivirus was quantified with the qPCR lentivirus titration kit (Applied Biological Materials, catalog #: LV900), and stored at −80°C.
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined using a qPCR Lentivirus Titration Kit (#LV900, Applied Biological Materials). For lentiviral transduction ...
-
bioRxiv - Genetics 2024Quote: Titer determination was performed with a RT-qPCR Lentivirus Titer Kit (Applied Biological Materials Inc.) according to the manufacturers’ instructions.
-
bioRxiv - Bioengineering 2020Quote: ... Human SV40-immortalized microglia are purchased from Applied Biological Materials, Inc and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Genetics 2020Quote: ... human recombinant EGF (20 ng/mL; ABM, Richmond, BC, Canada) and human recombinant bFGF-2 (10ng/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... COL-hTERT (Immortalized Human Colon Cells) were purchased from ABM. TM31 were obtained from RIKEN BioResource Research Center ...
-
bioRxiv - Neuroscience 2023Quote: ... Human KCNJ3-HA plasmid was purchased from Applied Biological Materials (Richmond ...
-
bioRxiv - Bioengineering 2024Quote: Human BM-MSC (iMSCs: Applied Biological Materials, Richmond, BC, Canada) was expanded in Dulbecco’s modified Eagle’s medium (Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative real-time PCR was performed using the EvaGreen qPCR Mastermix (Applied Biological Materials, BC, Canada), and the results were normalized to the signals of GAPDH expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral titers were obtained using ABMgood qPCR Lentivirus Titer Kit (Applied Biological Materials, Cat. no. LV900). All vectors were confirmed by restriction digest and Sanger sequencing ...
-
bioRxiv - Genetics 2020Quote: ... The target genes were detected using a Brightgreen 2× qPCR Mastermix low-rox (#Mastermix-lr; ABM.). The details of the primers used in these assays are given in Supplementary Table 1 in the Supplementary Information.
-
bioRxiv - Microbiology 2023Quote: ... The viral titer of concentrated viruses was calculated using the qPCR Lentivirus Titration Kit from ABM (Applied Biological Materials ...
-
bioRxiv - Bioengineering 2024Quote: ... The viral titer was determined by RT‒qPCR using the titer kit from Applied Biological Materials prior to use.