Labshake search
Citations for Bio-Rad :
101 - 150 of 10000+ citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time PCR reactions were run on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) paired with the CFX Manager software (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... and quantitative real-time PCR was performed in a CFX96 Real-Time PCR Detection System (Bio-Rad) using SsoFast EvaGreen Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed in triplicate with the CFX ConnectTM Real-Time PCR Detection system (BioRad) using SsoAdvancedTM Universal SYBR® Green Supermix (BioRad) ...
-
bioRxiv - Neuroscience 2024Quote: Quantitative real-time PCR was performed in an CFX384 Touch Real-Time PCR Detection System (Bio-Rad) using Power SYBR Green Master Mix (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative RT-PCR (RT-qPCR) with reverse transcription was performed on a the CFX96 Touch Real-Time Detection system (BioRad) using the Luna Universal One-Step RT-qPCR kit (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: ... 100 ng of RNase-treated DNA and 100 copies HIV-1 plasmid pNL4-3.Luc.R-E-were used as template to perform semi-nested RT-qPCR (following above mentioned procedure) and RT-LAMP on a CFX96 Touch Real-Time PCR Detection System thermocycler (BioRad) following a thermal program of continuous 65°C with fluorescence read every 30 s for 180 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... Real time quantitative PCR (qRT-PCR) was performed using an iQTM5 Multicolor Real-Time PCR Detection System (BIO-RAD) with qPCRBIO SyGreen Mix fluorescein (PCR BIOSYSTEMS) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR was conducted using the CFX96 Touch-Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA). Reaction mixtures and cycling conditions were performed as previously described (49) ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative RT-PCR was performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad; https://www.bio-rad.com) and SsoAdvanced PreAmp Supermix Biorad kit (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad). Rpl19 mRNA levels were used for normalization and the ΔΔCt method (70 ...
-
bioRxiv - Bioengineering 2022Quote: ... Real-Time PCR Detection System (Bio-Rad Laboratories, California) was used to detect mRNA expression of target genes ...
-
bioRxiv - Cell Biology 2022Quote: ... on a CFX384 Real-Time PCR Detection system (Biorad). Expression of each gene was normalized to the housekeeping gene ALG9 and expressed as fold change after 1.5h rapamycin treatment calculated using delta-delta Ct method.
-
bioRxiv - Molecular Biology 2021Quote: ... and CFX384 Touch Real-Time PCR Detection Systems (BioRad). Relative levels of transcript expression were quantified by the comparative ΔΔCt method with normalisation to RPL19 levels ...
-
bioRxiv - Immunology 2019Quote: ... The CFX384 TouchTM Real-Time PCR Detection System (BioRad) was used to obtain the raw CT values ...
-
bioRxiv - Systems Biology 2019Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad) were used for quantitative PCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... using CFX384 Real-Time PCR Detection System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... in CFX96TM Real-Time PCR Detection system (Bio-Rad). Ribosomal protein S14 (RPS14 ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: ... and a Real-Time PCR Detection System (Bio-Rad). The cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). Primer sequences are available upon request.
-
bioRxiv - Microbiology 2021Quote: ... using CFX96 Real-Time PCR Detection System (Bio-Rad) and 500 nM SARS-Cov-2 nsp1-specific CCTCAACTTGAACAGCCCTATG forward and GAATGCCTTCGAGTTCTGCTAC reverse primers.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The CFX96 Real-Time PCR Detection System (Bio-Rad) was used to monitor fluorescent intensity during amplification ...
-
bioRxiv - Neuroscience 2021Quote: ... in iQ5 Real-Time PCR Detection System (Bio-Rad). A portion of the m-hCDKL5 (Fw 5’-CTTAAATGCAGACACAAGGAAACAC-3 ‘ ...
-
bioRxiv - Microbiology 2020Quote: ... on CFX96 TouchTM Real-Time PCR Detection System (BioRad). The genome sequence of P ...
-
bioRxiv - Cell Biology 2021Quote: ... The CFX Connect Real-Time PCR Detection System (BioRad) was used to run RTq-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a Real-Time PCR Detection System (Bio-Rad). Bacterial strains were grown for 2 hours at 37°C under inducing conditions in LB ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). The data were analyzed by the comparative threshold method ...
-
ATM-mediated DNA damage response in macrophages primes phagocytosis and immune checkpoint regulationbioRxiv - Immunology 2020Quote: ... on CFX96TM Real-Time PCR Detection System (Bio-Rad). The cDNA was added to qPCR buffer Master-mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... CFX96 Real-Time PCR detection system (Bio-Rad Laboratories), or CFX384 Real-Time PCR detection system (Bio-Rad Laboratories).
-
bioRxiv - Microbiology 2022Quote: ... in a CFX96 real-time PCR detection system (BioRad). Specific primers were designed using the PrimerQuest tool (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Physiology 2019Quote: ... on a CFX384 Real-Time PCR Detection system (BioRad). 2.8 ng cDNA was added to each well ...
-
bioRxiv - Cancer Biology 2019Quote: ... and CFX96 Real-Time PCR detection system (Bio-Rad). The primers used for real-time PCR were designed based on the Universal Probe Library (Roche ...
-
bioRxiv - Immunology 2019Quote: ... in CFX96 Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... on CFX96 real-time PCR detection system (BIO-RAD). QPCR data were analyzed on CFX manager 3.1 (BIO-RAD).
-
bioRxiv - Neuroscience 2021Quote: ... by CFX384 Touch Real-Time PCR detection system (BioRad). Primers were optimized and designed to hybridize with different exons ...
-
bioRxiv - Biochemistry 2022Quote: ... A CFX384 Touch Real-Time PCR Detection System (BioRad) was used with the following cycling parameters ...
-
bioRxiv - Bioengineering 2022Quote: Real-Time PCR Detection System (Biorad, CFX96 or CFX384)
-
bioRxiv - Molecular Biology 2022Quote: ... using CFX96 Touch Real-Time PCR Detection System (BIORAD) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and CFX96 Touch Real-Time PCR Detection System (Biorad). The primer set for qPCR is ‘GGGGTGCTATCAGAGGCATC’ and ‘TAGGACCCTTGGTACCGGAG’.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The CFX96 Touch Real-Time PCR Detection System (Biorad) was used and quantification was performed with the DDCt method ...
-
bioRxiv - Cell Biology 2022Quote: ... The CFX96 Touch Real-Time PCR Detection System (Biorad) was used ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using CFX384 Real-Time PCR Detection System (Bio-Rad). The specific primers for qPCR are listed in Supplemental Table S5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... CFX Connect Real-Time PCR detection system (Bio-Rad) was used for measurement and analysis.
-
bioRxiv - Molecular Biology 2023Quote: ... on a CFX384 Real-Time PCR Detection System (BioRad) using the following thermal cycling conditions ...
-
bioRxiv - Microbiology 2023Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with CFX-96 Real-Time PCR Detection System (BioRad). The primers used in this study targeting histone H4C5 are ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and CFX Real-Time PCR Detection System (Bio-Rad). The data were analyzed by CFX Maestro qPCR Analysis Software (Bio-Rad) ...