Labshake search
Citations for Bio-Rad :
451 - 500 of 6169 citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Sybr-Green RT-PCR was performed using the SsoAdvanced Universal SYBR® Green Supermix (Bio-Rad) and analyzed by the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR analysis was performed using the iTaq™ Universal SYBR® Green Supermix (Bio-Rad) with two individual parent sets and two technical replicates on the CFX96TM Real Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR analysis was performed using the iTaq™ Universal SYBR® Green Supermix (Bio-Rad) with two individual parent sets and two technical replicates on the CFX96TM Real Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: Real-time RT PCR was performed in a CFX 96 thermocycler (Bio-Rad, Hercules, CA, USA) in a total reaction volume of 20 µL ...
-
bioRxiv - Physiology 2024Quote: ... Quantitative RT-PCR analysis was performed using the SsoAdvanced Universal SYBR Green Supermix kit (Biorad, #1725271) and the CFX96 Real-Time PCR detection system (Biorad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... iTaq Universal SYBR Green One step RT-PCR kit (cat# 1725150) was purchased from Bio-Rad. Mature miR-146a (cat# YP00204688) ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA samples were analysed by RT-PCR with iTaqTM Universal SYBR® Green supermix (Bio-Rad) and the following gene-specific primers (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2024Quote: ... The RT-qPCR result was acquired by CFX Connect Real-Time PCR Detection System (Bio-Rad) using the following primers:
-
bioRxiv - Cancer Biology 2024Quote: ... RT-qPCR was performed and analyzed using CFX96 Real-Time PCR Detection System (Bio-Rad 1845096) and using Power SYBR Green PCR Master Mix (Thermo Fisher 4368577) ...
-
bioRxiv - Microbiology 2021Quote: ... this gene was amplified from its gDNA using two set of primers: 27F/781R and 359F/1494R (Neilan et. al, 1997; Nubel et al., 1997) in a MyCycler (Bio-Rad laboratories Inc., Hercules, CA, USA) or T-Professional Standard (Analytik Jena ...
-
A gut-secreted peptide controls arousability through modulation of dopaminergic neurons in the brainbioRxiv - Neuroscience 2020Quote: ... DNA product was diluted 1:10 and used to set up quantitative PCR reactions using Sybr Green (Biorad #170-8880). Primers were obtained from ID Technologies:
-
bioRxiv - Microbiology 2021Quote: ... using an oligo(dT)20 primer in a BIO-RAD T100™ PCR thermocycler (BioRad, Hercules, CA) using a modified protocol for viral envelope protein ...
-
bioRxiv - Cancer Biology 2021Quote: ... quantitative PCR (qPCR) was performed using 500 nM primers and SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). The reaction conditions consisted of a 30-s 95°C enzyme-activation cycle ...
-
bioRxiv - Cancer Biology 2020Quote: ... and a desired primer pair on the CFX Connect™ Real-Time PCR Detection System (Bio-Rad). The cycling conditions used were ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and specified primers (Table 1) on a CFX96™ Real-time-PCR System (Bio-Rad Laboratories, USA). The thermal profile used for RT-qPCR was 95 °C for 10 min ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative PCR (primers listed in Table S10) was performed using SSO Universal SYBR Green Supermix (Bio-Rad) on a CFX96 machine (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and gene-specific primers (Supplementary Table 9) on a CFX384 Touch Real-Time PCR Detection System (BioRad). TBP (TATA-binding protein ...
-
bioRxiv - Pathology 2020Quote: ... and specific primers (Table 1) were performed using a CFX Connect Real-Time PCR Detection System (BioRad). Relative expression of mRNAs was determined using the software CFX Maestro (BioRad ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT PCR was performed with gene-specific primers (Table S1) using iTaq universal SYBR Green Supermix (BioRad) for 45 cycles on CFX96 Real time system (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... was used for quantitative real time PCR with commercially available rat Magel2 and Gapdh primers (Bio-Rad, USA ...
-
bioRxiv - Microbiology 2023Quote: ... and qRT-PCR was carried out with specific primers (Table S2) and iQ SYBR green Supermix (Biorad) using CFX96 real time system (Biorad) ...
-
bioRxiv - Immunology 2021Quote: ... DNA contamination in the treated RNA samples was assessed by performing a qPCR cycling with tilapia elongation factor 1α (EF-1α) primers using No-RT master mix (absence of reverse transcriptase enzyme provided in iScript™ Reverse Transcription kit, Bio-Rad, USA). The cDNA synthesis (20 µL reactions ...
-
bioRxiv - Cell Biology 2020Quote: ... and GAPDH (forward CAAGGTCATCCATGACAACTTTG and reverse GTCCACCACCCTGTTGCTGTAG) by RT-PCR using the SYBR Supermix (Bio-Rad Laboratories) on a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative RT-PCR was performed using the PerfeCTa SYBR Green SuperMix (Quantabio, 95071) on CFX96 system (Biorad) following manufacturer instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR (RT-qPCR) was performed on a CFX96 qPCR detection system (Bio-RAD™) using SYBR® GreenER™ qPCR SuperMixes (Life Technologies™) ...
-
bioRxiv - Genetics 2019Quote: ... Quantitative RT-PCR were performed using ddPCR (digital droplet) Supermix for Probes (186-3024, BioRad, Hercules, CA) on a Bio-Rad QX200 droplet digital PCR system (BioRad) ...
-
bioRxiv - Biochemistry 2020Quote: ... Real-time RT quantitative PCR reactions were performed in a CFX96™ Real-Time System (Bio-Rad) using the GoTaq® qPCR Master mix (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR reactions were run on an CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). The primer sequences were designed using Vector NTI software (Thermo-Fischer) ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was reverse transcribed using iScript Reverse Transcription Supermix for RT-PCR (Bio-Rad Laboratories, Hercules, CA). Then RT-qPCR was conducted using SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories) ...
-
bioRxiv - Bioengineering 2020Quote: ... The RT-qPCR samples were then measured using the CFX96 Touch Real-Time PCR Detection System (BioRad) using the following thermocycling protocol ...
-
bioRxiv - Bioengineering 2020Quote: ... RT-PCR was performed using Biometra T-Personal Thermal Cycler with iScript Reverse Transcription Supermix (Bio-Rad). qPCR was performed using the Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... was used to perform the RT-qPCRs with a CFX96 Touch Real-Time PCR Detection System (BioRad). Reactions contained 7 µL Applied Biosystems SYBR Green qPCR Master Mix ...
-
bioRxiv - Biophysics 2021Quote: ... QPCR was performed with the Applied Biosystems 7900HT RT-PCR instrument using SYBR Green Supermix (Bio-Rad) with indicated primers ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... the RT-PCR reaction was assembled in SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad, 1725271) with 0.5μM of each primer ...
-
bioRxiv - Immunology 2022Quote: ... Diluted pre-amplification product was used to complete RT-PCR using iTaq Universal SYBR Green Supermix (BioRad) and 16s M ...
-
bioRxiv - Developmental Biology 2022Quote: ... A BioRad CFX96 RT system was used to perform qRT-PCR using SsoAdvanced Universal SYBR Green (BioRad). n=3 technical replicates (i.e. ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: RT-PCR was performed on cDNA as prepared above using a CFX Connect real-time system (Biorad) with iTaq Universal SYBR Green Supermix (Biorad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR gene amplification was carried out using the CFX-96 thermocycler (Bio-Rad, Mississauga, ON) using the primers listed in Supplementary Table S1A ...
-
bioRxiv - Molecular Biology 2019Quote: ... using a 96-well Bio-Rad CFX96 RT-PCR System with a C1000 Thermal Cycler (Bio-Rad). A Cq value was obtained from each amplification curve using CFX96 Analysis Software provided by the manufacturer ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCRs were carried out using a Bio-Rad iCycler (CFX96, Bio-Rad, Santa Rosa, California, USA) with the following cycling conditions ...
-
bioRxiv - Genomics 2021Quote: ... RT-PCR amplicons were electrophoresed on 2 % agarose gels and imaged on a ChemiDoc MP (Bio-Rad). The resulting images were analyzed using ImageJ (v1.52a) ...
-
bioRxiv - Immunology 2021Quote: ... Real time RT-PCR was performed using iTaq™ Universal SYBR® Green Supermix (Bio-Rad Laboratories). Expression data was normalized to Gapdh mRNA levels ...
-
bioRxiv - Plant Biology 2021Quote: ... and quantitative reverse transcription PCR (RT-qPCR) was performed using the CFX96™ Thermal Cycler (Bio-Rad) and GoTaq® Master Mix (Promega) ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative RT-PCR was performed using SsoFast™ EvaGreen® Supermix with Low ROX (Bio-Rad, 1725212) on a CFX96™ Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... SYBR Green quantitative (q)RT-PCR was performed using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) on a StepOnePlus system (Applied Biosystems ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... Real-time RT-PCR was performed using iTaq™ Universal SYBR® Green Supermix (Bio-Rad Laboratories). Expression data were normalized to Gapdh mRNA levels ...
-
bioRxiv - Immunology 2022Quote: ... Real time RT-PCR was performed using iTaq™ Universal SYBR® Green Supermix (Bio-Rad Laboratories). Gene expressions were normalized to Gapdh mRNA levels ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR experiments were all performed using a CFX Connect Real Time PCR Detection System (Bio-Rad). For expression analyses ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA samples were analyzed by quantitative Real Time (RT)-PCR using SYBR Green supermix (Bio-Rad, 1725271), following standard procedures in a CFX96/C1000 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: RT-qPCRs were run on the Bio-Rad® CFX96 TM Real-Time PCR System (Bio-Rad) with SYBR-green based detection of PCR products ...