Labshake search
Citations for Bio-Rad :
501 - 550 of 10000+ citations for rno mir 137 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... in the CFX384 Touch Real-Time PCR Detection System (Bio-Rad, France). Primers used in RT-qPCR analyses are listed below ...
-
bioRxiv - Molecular Biology 2021Quote: ... Data were acquired on CFX96 Real-Time PCR detection System (Bio-rad). Samples were analysed in triplicates and the expression level was calculated relative to zebrafish housekeeping gene EF1α ...
-
bioRxiv - Neuroscience 2021Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 5.
-
D-alanylation of Teichoic Acids in Bacilli impedes the immune sensing of peptidoglycan in DrosophilabioRxiv - Immunology 2019Quote: ... qPCR was performed on an iQ5 Real Time PCR detection system (Biorad) using iTaq Universal Syber Green supermix (Biorad) ...
-
bioRxiv - Neuroscience 2019Quote: ... in a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Relative quantification of mRNA abundance was performed using Biogazelle qBASE plus-2 software ...
-
bioRxiv - Developmental Biology 2019Quote: ... or the CFX384 Touch™ Real-Time PCR detection system (Bio-Rad) with the my-Budget 5x EvaGreen (R ...
-
bioRxiv - Microbiology 2019Quote: ... performed on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Primer efficiency was calculated for each primer set and efficiencies between 95% and 105% were deemed acceptable ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we used the CFX Connect Real-Time PCR Detection System (Bio-Rad) using TB Green Premix Ex Taq II (Tli RnaseH Plus ...
-
bioRxiv - Immunology 2021Quote: ... on CFX96 real-time PCR detection machine (Bio-Rad, Hercules, CA, USA) with specific primers listed in Supplementary Table S1 ...
-
bioRxiv - Bioengineering 2020Quote: ... on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). The same method was used for polarization assays on BMDMs ...
-
bioRxiv - Pathology 2021Quote: ... and CFX96 Touch Real-Time PCR Detection System (Bio-Rad, CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, 1855195) with 1 ng cDNA and primers listed in Table S4 ...
-
bioRxiv - Neuroscience 2020Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 4.
-
bioRxiv - Microbiology 2021Quote: ... in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA). The amplicon library was diluted to 7 pM containing 20 % PhiX before sequencing on the MiSeq platform (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... and the CFX Maestro™ Real-Time PCR detection system (Bio-Rad). Dilutions of cDNA template for both standards and all unknowns were run in triplicate with reaction volumes of 10 μl ...
-
bioRxiv - Microbiology 2020Quote: ... on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad), and data were normalized to internal control GAPDH ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was run on CFX Connect Real-Time PCR Detection System (BioRad) using Kapa Probe Fast Universal qPCR Kit (Kapa Biosystems #KK4702) ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed using CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The expression levels were normalized to the internal control actin and GAPDH gene expressions ...
-
bioRxiv - Cell Biology 2020Quote: ... and quantified in a CFX96TM Real-Time PCR Detection System (Bio-Rad). The levels were normalized to the levels of act-1 and/or pmp-3 cDNA.
-
bioRxiv - Plant Biology 2022Quote: ... performed on a CFX96 real-time PCR detection system (Bio-Rad Laboratories). The reference gene was selected by comparing the AtUBC9 (ubiquitin conjugating enzyme 9) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Bio-Rad CFX96 touch Real-Time PCR detection system (Bio-Rad). mRNA levels were normalized to their corresponding GAPDH expression levels ...
-
bioRxiv - Neuroscience 2022Quote: ... on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Logarithmic regression was used to plot Ct values against a known number of copies and absolute mtDNA copies number for each sample was calculated as previously described (Gonzalez-Hunt et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... on CFX96 Real-Time PCR Detection System (C1000 Thermal Cycler, Bio-Rad). All primers used in this study are listed in Table EV1.
-
bioRxiv - Microbiology 2022Quote: ... on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, 1855195). Primer sequences can be found in Supplemental Table 1.
-
bioRxiv - Developmental Biology 2022Quote: ... and the iQ™5 Real-Time PCR Detection System from BioRad according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and the CFX96 Touch Real-Time PCR Detection System (Bio-RAD, 1855196). Changes in gene expression levels were determined relative to the housekeeping gene RPLP0 (5′- CTCTGCATTCTCGCTTCCTGGAG -3′ and 5′- CAGATGGATCAGCCAAGAAGG -3′ ...
-
bioRxiv - Neuroscience 2021Quote: ... in CFX384 Touch™ Real-Time PCR Detection Systems (Bio-Rad Laboratories). To normalize the expression data ...
-
bioRxiv - Neuroscience 2020Quote: ... on a CFX96 Real-Time PCR Detection System (Cat# 1855195, Bio-Rad). The following primers were used ...
-
bioRxiv - Neuroscience 2020Quote: ... in a MyiQ Single Color Real-Time PCR Detection System (Bio-Rad), with each reaction performed at a 20 μl sample volume in an iCycler iQ PCR 96-well Plate (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was conducted using CFX Connect Real-Time PCR Detection System (BioRad). All qPCR data was normalized to GAPDH and RPL13 which are used as housekeepers ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 5 The expression of individual genes is normalized to expression level of Gapdh ...
-
bioRxiv - Neuroscience 2022Quote: ... and a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Canada). Hippocampal and jejunal samples were analyzed in triplicates ...
-
bioRxiv - Microbiology 2019Quote: ... A CFX Connect Real Time PCR Detection System (Bio-Rad, CA, USA) was used to amplify the DNA templates according to the following program ...
-
bioRxiv - Genetics 2020Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 3.
-
bioRxiv - Microbiology 2019Quote: ... using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Results were analysed using CFX Maestro v4.1.2433.1219 software.
-
bioRxiv - Neuroscience 2019Quote: ... on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, USA). The primers used are presented as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were run on a CFX384 Real-Time PCR Detection System (BioRad). Met Ct values were normalized to Tfrc using ΔΔCt and compared to normal mouse DNA.
-
bioRxiv - Plant Biology 2020Quote: ... on CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, USA) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Amplification proceeded using a CFX96 Real-Time PCR Detection System (Bio-Rad) to incorporate a unique sample index/tag sequence and the sequencing adaptors for each sample using the following PCR settings ...
-
bioRxiv - Biochemistry 2020Quote: ... coupled to an iQ5 Multicolor Real-Time PCR Detection System (Bio-RAD). 96 well plates were used with each well containing a total volume of 100 µL consisting of 95% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was realized on CFX96 Touch Real-Time PCR Detection System (Biorad). Analysis of input RNA was performed in the same way on 100 ng of total RNA ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was run on CFX96 Touch Real-Time PCR Detection System (BioRad) with the following thermal profile ...
-
bioRxiv - Microbiology 2021Quote: ... A CFX96 Touch Real-Time PCR Detection system (Bio-Rad Laboratories Ltd) was used with the following conditions ...
-
bioRxiv - Plant Biology 2021Quote: ... using the CFX Connect™ Real-Time PCR detection system (BIO-RAD) with gene-specific primers listed in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Shanghai, China) was used under the following conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... and analyzed using CFX connect Real-Time PCR detection system (Bio-Rad). Primers for the qPCR were purchased from Euroventec (table 2).
-
bioRxiv - Physiology 2020Quote: ... performed with the CFX384 Touch Real-Time PCR Detection System (Bio-Rad), PCR master mix LightCycler 480 SYBR Green I Master (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... on a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-time PCR was performed on a CFX96 detection system (Bio-Rad) with SYBR Green reagents (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... which was performed on the CFX96 real-time PCR detection system (Biorad). Experimental results were normalized to β-Actin ...