Labshake search
Citations for Bio-Rad :
1 - 50 of 9038 citations for pTH Related Protein Splice Isoform 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: The expression of the Triobp alternative splice isoforms was quantified using a QX200 ddPCR System (Bio-Rad, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... PTH (1:1000, Bio-Rad, Hercules, California). Fluorochrome–conjugated secondary antibodies Cy3 and Cy5 (Bethyl ...
-
bioRxiv - Cell Biology 2021Quote: ... To detect OPA1 isoforms proteins were resolved on 7.5% Mini-PROTEAN TGX Precast Gels (Bio-Rad). Then proteins were transferred to a 0.2-μM PVDF membrane by Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... and molecular weights were measured related to the proteins ladder (Precision PlusProtein All Blue Standards #1610373, Bio-Rad) using the Image Lab analysis software (Bio-Rad) ...
-
bioRxiv - Immunology 2024Quote: ... and specific primers for ANKRD55 isoform 201 (Bio-Rad) were used to generate droplets in a QX200 Droplet Generator (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Immunostaining was performed overnight at 4° C using primary antibodies for PTH (1:400, Bio-Rad, Hercules, CA), Cleaved caspase 3 (1:200 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration of VSW-3 RNAP was determined by Bradford protein quantitative kit (Bio-rad), and protein purity and concentration were analyzed along with T7 RNAP (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: TGF-beta isoforms were measured with the Bio-Plex Pro TGF-β assays (Bio-Rad) in accordance with manufactures directions ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Plant Biology 2020Quote: ... Endpoint analysis and allelic discrimination related to SNP calls were accomplished using the CFX96 Touch™software (BioRad, CA, USA). The DNA of the restorer line Primepi was used as a reference control for Rf3 (Geyer et al ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated on a 3-8% Criterion XT tris-acetate gel (Biorad) or 4-15% Criterion TGX gel according to the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 3 uL Precision Plus Protein All Blue prestained standards (Bio-Rad, #1610373) loaded as a ladder ...
-
bioRxiv - Genetics 2021Quote: ... Ratios of active phosphorylated ROR2 : unphosphorylated ROR2 isoforms were calculated by quantitating band intensity using ImageLab 5.2.1 software (BioRad Inc.) for three biological replicates ...
-
bioRxiv - Immunology 2022Quote: ... The gel images were acquired using a ChemiDoc™ MP Imaging System and quantification of the pDNA isoform ratios were determined through densitometric analysis using the software ImageLab 6.0.1 (BioRad, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... kinase-dead extracts were incubated 3 consecutive times with protein A-beads (Bio-Rad) previously coated with the anti-B55δ antibody (1 hour incubation at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μg of the protein samples were prepared with 4X Laemmli loading buffer (Biorad) and denatured at 95°C for 5 minutes ...
-
bioRxiv - Genetics 2022Quote: ... from individuals with DMBT1 size isoform I-IV phenotypes were separated by electrophoresis on 4-15% gradient SDS-PAGE gels (BioRad) and subjected to Western blot-like binding of biotinylated bacteria ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 ng of cDNA was analyzed with isoform-specific droplet digital PCR assays and ddPCR Supermix for probes (Bio-Rad). Primers and probes (Integrated DNA Technologies ...
-
Negative curvature-promoting lipids instruct nuclear ingression of low autophagic potential vacuolesbioRxiv - Cell Biology 2021Quote: ... The same volume of supernatant was used to separate GFP from GFP-Atg8 isoforms onto a commercial 4–20% acrylamide gradient gel (BioRad) and migrated 45 min at 100 V in 1x MES buffer ...
-
bioRxiv - Plant Biology 2020Quote: Forward and reverse new PCR primers for the 12 Zn transport-related genes and the two reference genes suitable for SYBR® Green II RT-qPCR assays (Biorad, USA) were designed (Table 2) ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed for the expression of the exosome production-related genes listed in Appendix Table 1 by RT-PCR on a CFX Connect Real-Time System (Bio-Rad Laboratories).
-
bioRxiv - Biochemistry 2020Quote: ... The 3 mg/mL protein sample was injected onto NGC Liquid Chromotography System (Bio-Rad) equipped with a HiPrep Sephacryl S-500 HR column equilibrated in FPLC buffer and separated into 156 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were separated by 3-8% or 8-16% SDS-PAGE (NU-PAGE or BioRad) and transferred to immobilon-P membranes (Millipore) ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 3 µg protein was separated by SDS-PAGE gel electrophoresis (Bio-Rad) and transferred to 0.2 µm nitrocellulose membrane (Amersham™ Protran™ ...
-
bioRxiv - Microbiology 2023Quote: ... 40 µg of proteins were loaded onto 3–8% precast polyacrylamide gel (Bio-Rad, 3450129). After migration ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted using a 20:7:3 mixture of buffer: 4x Laemmli sample buffer (Biorad):10x NuPage sample reducing agent (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 final 10-minute TBST washes were followed by visualization of proteins with ECL (BioRad, 11705062). Densitometry analysis was performed using ImageLab 6.0 software (BioRad ...
-
bioRxiv - Physiology 2022Quote: For the separation of myosin heavy chain isoforms a large format SDS-PAGE setup with integrated cooling core was used (Protean II xi, Bio-Rad Laboratories, Inc.). A 5% stacking gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼3 million cells were harvested and proteins were extracted by boiling in 2x Laemmli sample buffer (BioRad). Protein levels were measured by Western blotting with different antibodies (Rabbit anti- BRWD3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg of protein was separated on 4% to 20% precast polyacrylamide gels (Bio-Rad, cat # 4561095) for detection of histone H3 andH3K27me3 ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified MCU-EMRE subcomplex in DDM was then reconstituted into nanodisc by incubating with Msp1 protein, lipids (POPC:POPE:POPG, 3:1:1 molar ratio) and BioBeads (BioRad) at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Biophysics 2022Quote: ... The protein-dye conjugate was purified by 3 rounds of size exclusion chromatography (Bio-Spin 6 column, BioRad, CA) and then aliquoted in 5 μL portions and stored at -80C until required.
-
bioRxiv - Microbiology 2022Quote: ... Proteins were separated using a gradient SDS PAGE gel (8-12%) and a Mini-Protean 3 Cell (Bio-Rad) at 85 V ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad) by using a Criterion blot cell (BioRad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scientific until approximately 3 cm of separation was obtained between the 25 and 37 kDa protein standards (Bio-Rad; 1610375). Using electrophoresis ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A total of 3 μg of protein was loaded to Mini-PROTEAN TGX Stain-Free Gels (10% gel, BIO-RAD). Proteins were transferred to standard PVDF membranes through an OWL semi-dry transfer apparatus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Bound proteins were washed 3 times in 500 mM KCl and eluted on Bio-spin disposable chromatography columns (Bio-Rad) with flag peptide as described in (88) ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...