Labshake search
Citations for Bio-Rad :
51 - 100 of 165 citations for p p' DDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 0.1 mM EDTA and 10% glycerol) with P-30 gel chromatography columns (Bio-Rad). Increasing concentrations (0.1-1.25 μM ...
-
bioRxiv - Immunology 2022Quote: ... One ml of sterile Bio-Gel P-100 polyacrylamide beads (Bio-Rad, 150-4174) in PBS (2% w/v ...
-
bioRxiv - Microbiology 2020Quote: ... un-conjugated dye was removed using a Micro Bio-Spin P-6 column (BioRad) at 1000 x g ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was purified on a Bio-Spin® P-6 Gel Columns (BioRad) desalting column equilibrated in BC-0 buffer to separate labeled protein from excess fluorophore and then stored at −80 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and subsequently purified using Micro Bio-Spin P-6 gel columns (Bio-Rad 7326221). The BG-oligos were then conjugated to SNAP-proteins by mixing at a 2:1 molar ratio in storage buffer (20 mM HEPES [pH 7.5] ...
-
bioRxiv - Molecular Biology 2019Quote: ... Gel exclusion chromatography on Bio-Gel P-6 acrylamide resin (Bio-Rad #150-0740) in renaturation and storage buffer RN#5 (0.1 M NaH2PO4 ...
-
bioRxiv - Microbiology 2021Quote: ... 0.1 mM EDTA and 10% glycerol) with P-30 gel chromatography columns (Bio-Rad). 10 μM proteins were oxidized for 15 min with 5- or 10-molar ratios of HOCl or H2O2 followed by addition of 1× non-reducing SDS sample buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Unquenched periodate was removed using Micro Bio-Spin P-6 columns (Bio-Rad Laboratories) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and purified by running through P-30 column (Bio-Rad Laboratories, Hercules, CA, USA). The 3′ end of the fragmented RNA was dephosphorylated with T4 polynucleotide kinase (PNK ...
-
bioRxiv - Biophysics 2023Quote: ... with free dye removed using a Bio-Spin P-6 gel column (BioRad, 7326227) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Unincorporated nucleotides were removed using Micro BioSpin™ P-30 Gel Columns (Bio-Rad). Plasmid length DNA binding experiments were performed with unlabeled circular or linearized M13mp18 single (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... the RNA was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Unincorporated nucleotides were removed using Micro BioSpin™ P-30 Gel Columns (Bio-Rad). The annealed substrate was purified using CHROMA SPIN™+TE-200 Columns (TaKaRa ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated biotin-NTPs were removed with RNase free P-30 columns (7326223; Bio-Rad), and three cycles of magnetic MyOne Streptavidin C1 bead purification (65002 ...
-
bioRxiv - Cell Biology 2023Quote: ... loaded with a 100 mg/ml Biogel P-10 Gel (Bio-Rad, Hercules, CA) solution ...
-
bioRxiv - Microbiology 2023Quote: ... and a buffer exchange was performed using a BioSpin P-30 column (Bio-Rad) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... The reaction was cleaned up by P-6 Micro Bio-Spin Column (Bio-Rad). For fluorophore labeling ...
-
bioRxiv - Neuroscience 2021Quote: ... and purified by passing through a P-30 Tris Micro Bio-Spin Column (Bio-Rad). Prior to hybridization ...
-
bioRxiv - Molecular Biology 2022Quote: ... afterwhich DNA was purified using Bio-Gel P-30 size-exclusion spin column (Bio-Rad). Then DNA was digested with SacI (Thermo Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... with the mini profinity IMAC and mini Bio-Gel P-6 desalting cartridges (Bio-Rad). The protein concentration and purity were verified by Bradford Protein Assay (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... and later purified by running through RNase-free P-30 column (Bio-Rad, Hercules, CA). PNK was used to dephosphorylate RNA for 2 hours (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Beads SM-2 Resin and Bio-Gel P-6 were obtained from Bio-Rad Laboratories Inc ...
-
bioRxiv - Genomics 2020Quote: Micro Bio-Spin™ RNase free P-30 Gel Columns (Bio-Rad, cat. no. 7326250) (optional ...
-
bioRxiv - Biophysics 2022Quote: ... The modified probes were purified using a P-6 Micro Bio-Spin Column (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA probe was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad), denatured 5 min in 95°C and cooled on ice ...
-
bioRxiv - Molecular Biology 2023Quote: ... Water-resuspended RNAs were applied to Micro Bio-Spin P-30 columns (Bio-Rad, 7326250) for desalting.
-
bioRxiv - Cancer Biology 2023Quote: ... YAP S126-p were purchased from CST and rhodamine-conjugated β-tubulin from Bio-Rad and used for Western blotting ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Biochemistry 2020Quote: ... The complex was exchanged into EM buffer using a Bio-Spin P-30 column (Bio-Rad). The concentration of complex was estimated from absorbance at 280 nm and 1 equivalent of dsDNA (61 base pairs ...
-
bioRxiv - Microbiology 2020Quote: ... in a 100 μL reaction for 2 hours and purified using P-30 spin columns (BioRad). The radiolabeled probe was heated to 100°C for 2 minutes and resuspended in 10 mL of ULTRAhyb Oligo hybridization buffer (Ambion) ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Microbiology 2019Quote: ... a hand-packed Bio-Gel P-10 size exclusion column (1.5 × 50 cm, 1504144, Bio-Rad) was used ...
-
bioRxiv - Microbiology 2019Quote: ... a hand-packed Bio-Gel P-4 size exclusion column (1.0 × 50 cm, 1504128, Bio-Rad) was used for glycan separation ...
-
bioRxiv - Immunology 2020Quote: ... the reaction mixture was passed through 2 Bio-Gel P-2 mini columns (1504114, Bio-rad) by centrifugation (3000 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... P-ATG16L1-S278 antibody was diluted at 1:4000 in EveryBlot blocking buffer (Bio-Rad, 12010020) and incubated overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... The final reaction mix was desalted using Micro Bio-Spin P-30 columns (Bio-Rad, 7326250), then denatured by incubating with 0.5X volume of gel-loading buffer (8 M urea ...
-
bioRxiv - Cell Biology 2022Quote: ... Then the protein-dye conjugate was flowed through a gel separation column (Bio-rad Biogel P-30) to purify the labeled protein ...
-
bioRxiv - Microbiology 2021Quote: ... an assay detecting the human ribonuclease P/MRP subunit p30 RPP30 gene (Bio-Rad Assay ID dHsaCP2500350) was used as reference (probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 6.8 and the RNA was cleaned up with Micro Bio-Spin P-30 gel columns (Biorad). RNA was biotin-labelled with 50 μl 0.1 mg/ml MTSEA biotin-XX linker (Biotium ...
-
bioRxiv - Cell Biology 2022Quote: ... Unconjugated dye was removed by passing the protein through Micro Bio-spin P-6 column (Bio-rad) equilibrated in GF150 buffer (25 mM HEPES (pH 7.4) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The labeled ASC-ST-DLL4 was then purified by desalting on a P-30 column (Bio-Rad). The final molar ratio of JF646 to ASC-ST-DLL4 was 5:1.
-
bioRxiv - Plant Biology 2023Quote: ... the treated protein was cleaned up using a Micro Bio-SpinTM P-6 Gel Column (BIO-RAD), and then they were further subjected to 5 mM sodium (meta ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were further purified by performing a buffer exchange using P-30 columns (Bio-Rad, Hercules, CA) and another ethanol precipitation ...
-
bioRxiv - Biochemistry 2023Quote: ... The unconjugated dye was removed by size exclusion using Bio-Spin P-30 gel columns (Bio-rad) equilibrated in PBS pH 7.4 ...
-
bioRxiv - Plant Biology 2024Quote: ... The extracts were then desalted on Bio-Gel® P-6DG gel (BIO-RAD, Hercules, CA, USA) equilibrated with 20 mM sodium phosphate buffer pH 7.4 containing 0.15 M NaCl ...
-
bioRxiv - Biochemistry 2024Quote: ... DTT was removed using “Micro Bio-Spin® Columns with Bio-Gel® P-30” (Bio-Rad).
-
bioRxiv - Genomics 2020Quote: ... Labeled probes were then purified using Micro Bio-Spin® Columns with Bio-Gel® P-30 (BioRad).
-
bioRxiv - Cell Biology 2019Quote: ... the removal of unreacted dye was done via gel filtration in Bio-Gel P-30 Gel (Bio-Rad). On average ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was purified by loading quenched samples onto Micro Bio-spin Columns with Bio-Gel P-6 (BioRad), followed by ethanol precipitation ...