Labshake search
Citations for Bio-Rad :
1 - 50 of 266 citations for Urotensin II Related Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: Forward and reverse new PCR primers for the 12 Zn transport-related genes and the two reference genes suitable for SYBR® Green II RT-qPCR assays (Biorad, USA) were designed (Table 2) ...
-
bioRxiv - Microbiology 2022Quote: ... and molecular weights were measured related to the proteins ladder (Precision PlusProtein All Blue Standards #1610373, Bio-Rad) using the Image Lab analysis software (Bio-Rad) ...
-
bioRxiv - Plant Biology 2020Quote: ... Endpoint analysis and allelic discrimination related to SNP calls were accomplished using the CFX96 Touch™software (BioRad, CA, USA). The DNA of the restorer line Primepi was used as a reference control for Rf3 (Geyer et al ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed for the expression of the exosome production-related genes listed in Appendix Table 1 by RT-PCR on a CFX Connect Real-Time System (Bio-Rad Laboratories).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The dried peptides were resuspended in deionized (dI) water for peptide estimation using Bradford’s assay (Bio-rad) (44).
-
bioRxiv - Microbiology 2022Quote: ... 960μF (Biorad GenePulse II) and resuspended in 6ml growth medium ...
-
bioRxiv - Microbiology 2020Quote: ... using MiniProtean II (Biorad) electrophoresis system ...
-
bioRxiv - Physiology 2022Quote: ... or 16.5% Criterion Tris-Tricine/Peptide gels (Bio-Rad) alongside two protein markers (Precision plus all blue and dual color standards ...
-
bioRxiv - Cell Biology 2021Quote: ... peptide was conjugated to Affi-gel resin (Bio-Rad) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the GenePulser II (Biorad). The cells were cultured with 1 μg/ml doxycycline overnight to induce the expression of EBNA2 ...
-
bioRxiv - Biochemistry 2023Quote: ... Tryptic peptides were eluted off with spin columns (BioRad, 7326204) under a vacuum manifold ...
-
bioRxiv - Biochemistry 2019Quote: ... using Equilibration Buffers I & II (BioRad) for 30 min each ...
-
bioRxiv - Genomics 2023Quote: ... in a Genepulser II (Bio-Rad). Immediately after electroporation ...
-
bioRxiv - Genetics 2021Quote: ... Dissolved peptide was coupled to Affi-Gel 10 resin (Bio-Rad) that had been washed 3 times in methanol ...
-
bioRxiv - Bioengineering 2019Quote: Gene Pulser II electroporator (Bio-Rad Laboratories)
-
bioRxiv - Biochemistry 2021Quote: ... followed by hydroxyapatite (CHT-II, Bio-Rad), and finished with SEC (Superose 6 Increase ...
-
bioRxiv - Cancer Biology 2023Quote: ... The DC protein assay kit II (BioRad) was used to quantify protein concentrations ...
-
bioRxiv - Cell Biology 2023Quote: ... using a Gene Pulser II (Bio-Rad) set at 1.8 kV ...
-
bioRxiv - Microbiology 2023Quote: ... and Foresight CHT Type II (Bio-Rad) columns with sodium phosphate gradient ...
-
bioRxiv - Genetics 2023Quote: ... via electrotransformation (Bio-Rad Gene Pulser II). Transformed bacteria were grown overnight and plasmid pools were extracted using the PureLink Midiprep Kit (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... Peptide cleavage products were resolved on 10-20% Tris-Tricine gels (BioRad) and RNase 7 samples were resolved on 20% SDS-PAGE gels.
-
bioRxiv - Immunology 2023Quote: ... free peptides were removed using a Bio-Spin P-30 column (Biorad), leaving the labeled PTM tetramers in the flowthrough ...
-
bioRxiv - Genomics 2020Quote: ... using a Gene Pulser II device (Bio-Rad). Transformed cells were recovered in S.O.C media (from ElectroMAX Stabl4 kit ...
-
bioRxiv - Cancer Biology 2019Quote: ... on a CHEF DR II equipment (Bio-Rad) under conditions of 120 field angle ...
-
bioRxiv - Plant Biology 2021Quote: ... using Gene Pulser II (Bio-Rad, Hercules, CA) with a 0.2 cm-gap cuvette at 2.5 kV cm-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... using a Gene Pulser II (Bio-Rad Laboratories) according to manufacturer’s instructions using the following electroporation conditions ...
-
bioRxiv - Biochemistry 2022Quote: ... using a Gene Pulser II electroporator (Bio-Rad), 3 µg linearized vector ...
-
bioRxiv - Genetics 2024Quote: ... using the DC Protein Assay Kit II (BioRad). Luciferase activities were measured on a GloMax Luminometer (Promega ...
-
bioRxiv - Biochemistry 2024Quote: ... Universal Hood II-Gel Doc system (Bio-Rad) was used to display the SDS-PAGE gel.
-
bioRxiv - Plant Biology 2020Quote: Agrobacterium tumefaciens (strain GV3101::mp90) was electroporated in the presence of 500 ng binary vector (pGreen II) using a gene pulser II (Biorad, USA) set to 2.5 kV ...
-
bioRxiv - Molecular Biology 2019Quote: ... Eluting peptides were collected for 72 min using a BioFrac fraction collector (Bio-Rad). Fraction collection pattern was set to row and fraction collection size was set to 0.75ml ...
-
bioRxiv - Neuroscience 2020Quote: ... and a rabbit anti-vasoactive intestinal peptide (1:500, catalog: 9535-0204, Bio-Rad). The secondary antibodies used in a study were as follows ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was incubated with CcdA peptide (residues 46-72) coupled Affi-gel15 (Biorad) overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... using a Gene Pulser II Electroporation System (Bio-Rad). Then ...
-
bioRxiv - Immunology 2021Quote: ... using a GenePulser II with Capacitance Extender (Bio-Rad). Cells were recovered at room temperature for 10 minutes and plated in 6-well culture plates in complete DMEM or RPMI for 24 hours at 37°C ...
-
bioRxiv - Pathology 2022Quote: ... using Bio-Rad Protein Assay Kit II (Bio-Rad), or DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... using a mini-protean II apparatus (Bio-Rad, UK) at a constant 85V ...
-
bioRxiv - Biophysics 2020Quote: ... linearized plasmid using a Gene Pulse II (Bio-Rad). Clone selection was performed as previously described by an in-house two-step transformant screening strategy 48 to maximize the expression of receptor for subsequent fluorescence labeling 49.
-
bioRxiv - Cancer Biology 2020Quote: ... using wet transfer Mini-PROTEAN II electrophoresis system (BioRad). Membranes were blocked in 5% skim milk (Fluka ...
-
bioRxiv - Molecular Biology 2019Quote: ... (ii) CL2_DM1_H+ (iScript RT, Bio-Rad, Hercules, CA, USA) consisted of 3 DM1 samples (from cell lines 9886 ...
-
bioRxiv - Biophysics 2021Quote: ... Cuvettes were transferred to a Gene Pulser II (BioRad) and pulsed with the following settings ...
-
bioRxiv - Cell Biology 2023Quote: ... Bio-Rad Protein Assay Kit II (Bio-Rad laboratories) was used to measure the acetylated tubulin concentration from the post-nuclear supernatant collected from the lysates ...
-
bioRxiv - Microbiology 2021Quote: ... The transformation was done by electroporation (Gene Pulser II, Biorad) using 1 µL of a 1:3 dilution of the assembly reaction (in ultrapure H2O) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Gene pulser II System (Bio-Rad Laboratories, Berkeley, CA) was used to electroporate the sample in a 0.4cm gap cuvette using 500V for 0.05 seconds ...
-
bioRxiv - Neuroscience 2020Quote: ... Nitrocellulose and PVDF (for LC3-II detection) membranes (Bio-Rad) were used for the transfer ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 μF pulse using GenePulser II (Bio-Rad, Hercules, USA). After electroporation ...
-
bioRxiv - Cancer Biology 2020Quote: ... and SYBR Premix Ex Taq II (Biorad, Hercules, CA, USA) with first strand cDNA ...
-
bioRxiv - Biochemistry 2020Quote: ... and purified on a CHT Ceramic Hydroxyapatite Type II (Biorad) column ...
-
bioRxiv - Biochemistry 2021Quote: ... It was further purified by hydroxyapatite (CHT-II, Bio-Rad) and heparin sepharose column chromatography (GE Healthcare) ...