Labshake search
Citations for Bio-Rad :
1 - 50 of 1885 citations for Trefoil Factor 3 TFF3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... and Growth Factor Assay (Biorad) and the Bio- Plex Pro TGFβ Assay (Biorad ...
-
bioRxiv - Microbiology 2019Quote: ... Factor H protein was purchased from Biorad and the mouse monoclonal IgG1 Factor H Antibody (OX24 ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Cancer Biology 2020Quote: ... epidermal growth factor (Serotec/Bio-Rad, EGF-1), hydrocortisone (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... A gate was established for each factor using negative control samples stained with mouse IgG1 negative control antibodies (BIO-RAD, MCA928) or polyclonal rabbit IgG (R&D Systems ...
-
bioRxiv - Microbiology 2020Quote: ... Excess antibody was washed away with 3 x TBST rinses before the membrane was incubated with anti-mouse secondary antibody (Bio-rad) conjugated to horseradish peroxidase at a 1:15000 dilution in TBST at 25°C for 1 hour ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected with 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad). The CA levels from cells were normalized relative to GAPDH levels ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were washed 3 times in TBSt and then incubated with HRP secondary antibodies (anti-Mouse HRP, Biorad, 170-6516 ...
-
bioRxiv - Biochemistry 2023Quote: ... membranes were washed 3 times in TBS-T and incubated for 45 minutes with secondary antibody (Bio-Rad: Goat Anti-rabbit #1706515 or Goat-anti mouse #1706516) ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 1ng/ml recombinant human fibroblast growth factor (FGF) basic (BioRad, Veenendaal, The Netherlands) and 0.1mM L-ascorbic acid (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 1ng/ml recombinant human fibroblast growth factor (FGF) basic (BioRad, Veenendaal, The Netherlands) and 0.1mM L-ascorbic acid (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed and blocked in 1x TBST with 5% bovine serum albumin before consecutive incubation with primary antibody (see Suppl. Table 3) and horseradish peroxidase-coupled protein A (Cymed) and detection using Clarity Western ECL Substrate (BioRad).
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Physiology 2023Quote: ... taking into account dilution factor (cell count estimated with the BIO-RAD TC20 automated cell counter). Repeatability of the ROS production measurements between sample-duplicates was R = 0.924 (CI 95% = [0.9 ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the membrane was blotted with the Chk1-pS345 antibody at the 1:3000 dilution for 3 h to detect the phosphorylated Chk1-Ser345 in ChemiDoc (Bio-Rad). The membrane was stripped ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed a further 3 times in TBS-T and bound antibodies were visualised using the Clarity Western ECL substrate (BioRad; #1705061) with a ChemiDoc MP system (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected by using a 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad, Hercules, CA) in 5% milk TBST (Tris buffer saline plus Tween-20) ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; Bio-Rad, 170-6516) for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were rinsed 3×10 minutes in TBST 0.1% then incubated with appropriate secondary antibody coupled to the horseradish peroxidase (Biorad, 1706515, 1706516; 1/5000) for 1 hour at room temperature under agitation ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... vascular endothelial growth factor (VEGF) and IL-18 were measured on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... The plate was washed 3 times prior to adding 50 μl of 1:1000 diluted Goat anti-Mouse IgG H+L-HRP antibody (Bio-Rad, Cat# 172-1011) to the plate and incubated for 1 h at RT ...
-
bioRxiv - Cell Biology 2022Quote: Cytokine and growth factor secretion was measured with the Bio-Plex Pro Human Cytokine Screening Panel (Bio-Rad #M500KCAF0Y), a 27-plex assay ...
-
bioRxiv - Biochemistry 2019Quote: ... Carboxylation of matrix Gla protein was determined as for the factor IX single turnover assay except for use of a Criterion 16.5% TRIS/TRICINE gel (BioRad) with [14C]fIX -18/+41 standards for quantization ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Microbiology 2022Quote: ... and growth factor protein expression was quantified using the Bio-Plex Pro Rat Cytokine 23-plex assay (Bio-Rad Laboratories, Inc). Analytes included in the assay were ...
-
bioRxiv - Physiology 2021Quote: ... chemokines and growth factors were quantitated by using a Bio-Plex Pro Mouse 23-plex Immunoassay and Bio-Plex Reader System (Bio-Rad).
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...