Labshake search
Citations for Bio-Rad :
1 - 50 of 1891 citations for Toll Like Receptor 3 TLR3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... anti-CD63 and anti-CD81 detection antibodies (supplied in the MACSPlex kit, 5 µl each) or anti-decoy receptor antibodies (AlexaFluor647-labelled anti-human TNFR1, Bio-Rad, cat #MCA1340A647 ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Microbiology 2023Quote: ... AOA and of nxrB from Nitrospira- like NOB were determined using a CFX96 qPCR cycler (Bio-Rad, USA). Primer pairs for quantification were comamoAF/ comamoAR for CMX amoA [11] ...
-
bioRxiv - Cell Biology 2019Quote: ... estrogen receptor (Santa Cruz sc-542, 1:20; BioRad MCA1799T, 1:25), Ltf (Bioss bs-5810 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Fc-receptors were then blocked for 15 minutes using FcBlock (BioRad – BUF041A). Cells were pelleted by centrifugation (300 x g ...
-
bioRxiv - Physiology 2024Quote: ... Fc-receptors were then blocked for 15 minutes using FcBlock (BioRad – BUF041A). Cells were pelleted by centrifugation (300 x g,5 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was collected as the periplasmic-like fraction (P) and solubilized by mixing with 4X Laemmli sample buffer (Bio-Rad). The pellet was resuspended with the same volume of the 1X M9+ medium and solubilized with 4X Laemmli sample buffer ...
-
bioRxiv - Physiology 2023Quote: ... and the pellet resuspended in 37.5µL of Na+-free intracellular-like medium (120mM KCl; 1mM KH2PO4; 20mM HEPES; pH 7.2) that had been cleared with Chelex 100 (Bio-Rad # 1422822) to remove trace Ca2+ ...
-
bioRxiv - Microbiology 2020Quote: ... Excess antibody was washed away with 3 x TBST rinses before the membrane was incubated with anti-mouse secondary antibody (Bio-rad) conjugated to horseradish peroxidase at a 1:15000 dilution in TBST at 25°C for 1 hour ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Biochemistry 2021Quote: ... The signal was normalized with respect to total receptor and quantified using ImageLab software (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... Band density of oxytocin receptor was quantified using Image Lab 6.0 (BioRad Laboratories, Hercules, CA) and normalized to GAPDH.
-
bioRxiv - Cancer Biology 2023Quote: ... the PrimePCR Estrogen receptor signaling (SAB Target List) H96 panel (Bio-Rad Laboratories, Hercules, CA, USA) was employed for RT-qPCR-based gene array analysis ...
-
bioRxiv - Immunology 2021Quote: ... specific for the various human chemokine receptor genes and IQ™ SYBR green reagent (# 170882, BIO-RAD) on CFX96 real-time PCR detection system (BIO-RAD) ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected with 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad). The CA levels from cells were normalized relative to GAPDH levels ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were washed 3 times in TBSt and then incubated with HRP secondary antibodies (anti-Mouse HRP, Biorad, 170-6516 ...
-
bioRxiv - Biochemistry 2023Quote: ... membranes were washed 3 times in TBS-T and incubated for 45 minutes with secondary antibody (Bio-Rad: Goat Anti-rabbit #1706515 or Goat-anti mouse #1706516) ...
-
bioRxiv - Immunology 2023Quote: ... to block Fc receptors and stained with biotinylated anti-mouse F4/80 (clone: Cl:A3-1, cat:MCA497B, BIO-RAD), PerCP-Cy5.5-conjugated streptavidin (551419 ...
-
bioRxiv - Cell Biology 2019Quote: ... Immunostaining for the vitronectin receptor (VNR) was with anti-CD51/61 (clone 23C6, 1:400; Bio-Rad, Oxford, UK) and for cathepsin K with a rabbit polyclonal antibody (3368-100 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed and blocked in 1x TBST with 5% bovine serum albumin before consecutive incubation with primary antibody (see Suppl. Table 3) and horseradish peroxidase-coupled protein A (Cymed) and detection using Clarity Western ECL Substrate (BioRad).
-
bioRxiv - Cell Biology 2023Quote: ... The reaction mixture was separated on SDS-PAGE and the phosphorylated receptor was autoradiographed for image analysis with the Quantity One program (BioRad) on phosphor screens.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed a further 3 times in TBS-T and bound antibodies were visualised using the Clarity Western ECL substrate (BioRad; #1705061) with a ChemiDoc MP system (BioRad) ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the membrane was blotted with the Chk1-pS345 antibody at the 1:3000 dilution for 3 h to detect the phosphorylated Chk1-Ser345 in ChemiDoc (Bio-Rad). The membrane was stripped ...
-
bioRxiv - Cancer Biology 2020Quote: ... spliced IL6 receptor and gp130 expression was assessed by PCR using the MJ Research Peltier Thermal Cycler Tetrad (Bio-Rad, Germany) with the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected by using a 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad, Hercules, CA) in 5% milk TBST (Tris buffer saline plus Tween-20) ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; Bio-Rad, 170-6516) for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were rinsed 3×10 minutes in TBST 0.1% then incubated with appropriate secondary antibody coupled to the horseradish peroxidase (Biorad, 1706515, 1706516; 1/5000) for 1 hour at room temperature under agitation ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 3 μL of the resuspended membrane pellets containing the receptors were run alongside membrane pellet of uninjected oocyte on 4–15% precast gradient TGX Stain-Free™ gels (Bio-Rad Laboratories) for 34 min at 200 V ...
-
bioRxiv - Neuroscience 2020Quote: ... The amount of surface expressed receptors was detected by adding 60 µL wash buffer and 20 µL HRP substrate (Bio-Rad, 170-5060) per well ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal anti-MF20 (DSHB, Cat# MF 20, dilution 1:20) rabbit polyclonal anti-Calcitonin Receptor (Bio-RAD, Cat# AHP635, dilution 1:2000), chick anti-GFP (abcam ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... The plate was washed 3 times prior to adding 50 μl of 1:1000 diluted Goat anti-Mouse IgG H+L-HRP antibody (Bio-Rad, Cat# 172-1011) to the plate and incubated for 1 h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...