Labshake search
Citations for Bio-Rad :
201 - 250 of 4789 citations for Testosterone 100 Ug Ml In Methylene Chloride 3 4 13C2 99%; 17 18O 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... for DpnII digested DNA or primers 3 and 4 (table S2) for NlaIII digested DNA on a thermal cycler (Bio-Rad C1000 Touch). PCR amplified samples were purified using the NucleoSpin Gel and PCR cleanup kit (Macherey-Nagel ...
-
bioRxiv - Biophysics 2020Quote: ... followed by gel filtration in 50 mM sodium citrate buffer (pH 5.5) and 150 mM sodium chloride using an ENrich SEC 650 size-exclusion chromatography column (Bio-Rad). Purified samples were concentrated using Amicon Ultracel-10K centrifugal filter units (EMD Millipore).
-
bioRxiv - Biochemistry 2023Quote: ... Proteins used for crystallization were further purified by gel filtration in 50 mM sodium citrate buffer (pH 5.5) and 150 mM sodium chloride using an ENrich SEC 650 size-exclusion chromatography column (Bio-Rad). Purified samples were concentrated using Amicon Ultracel-3K centrifugal filter units (EMD Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... and heated to 100 °C for 5 min and resolved on 4-20% (w/v) gradient SDS-PAGE gels (Bio-Rad) with Tris-glycine buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... was then added and the solution was mixed at 4°C for 10 minutes before addition of 100 mg of Biobeads SM2 (Bio-Rad). Biobeads were washed into methanol ...
-
bioRxiv - Biophysics 2019Quote: ... Temperature was increased at a rate of 1°C per minute from 4°C to 100°C and fluorescence was measured every minute with a qPCR thermocycler in FRET mode (Bio-Rad). Aggregation temperature was determined by locating the global minimum of the second derivative of the raw data ...
-
bioRxiv - Cancer Biology 2020Quote: ... Between 50 and 100 µg of total protein was loaded onto a gradient (4-15%) polyacrylamide gel (BioRad, Hercules, CA, USA). Proteins were then transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Neuroscience 2021Quote: ... All slides were subsequently blocked with 4% BSA and 1% Triton X-100 in PBS and incubated with rat anti-CD68 (1:500; Bio-Rad) and mouse-anti-GFP conjugated to Alexa Fluor 488 (1:250 ...
-
bioRxiv - Microbiology 2021Quote: ... Binding reactions were incubated for 40 minutes at 37 °C then run on a precast 5% TBE acrylamide gel at 4 °C for 45 minutes at 100 V (Bio-Rad). After transfer to Biodyne B Modified Nylon Membrane (ThermoFisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... and heated to 100 °C for 5 min and resolved on 4-20% (w/v) gradient SDS-PAGE gels (Bio-Rad) with Tris-glycine buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein extractions containing 5 µg of Chl with 1 x SDS loading buffer were boiled at 100℃ for 5 min and loaded onto a 4 - 20% polyacrylamide gel (Mini Protean TGX, Biorad Laboratories). Proteins were transferred to a PVDF-FL membrane on a Biorad semidry blotting system ...
-
bioRxiv - Microbiology 2023Quote: ... heated in water bath for 5 minutes at 99°C and analysed by SDS-PAGE using Any-kD Mini-PROTEAN TGX Stain-Free gels (Bio-Rad, California, USA) in a 2-minute run for sample clean-up purposes ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 ug) was converted to cDNA using the iScriptTM cDNA synthesis kit (# 1708891, BIO-RAD, Hercules, CA) following the manufacturer’s protocol (BIO-RAD ...
-
Transcriptome analyses reveal tau isoform-driven changes in transposable element and gene expressionbioRxiv - Neuroscience 2021Quote: ... 12.1 ug of protein from each sample was loaded onto a 10% Tris-Glycine gel (Biorad, cat no. 4561034) and then transferred onto a PVDF membrane and blocked for one hour with 5% BSA in 0.1% Tween/1xTBS ...
-
bioRxiv - Microbiology 2020Quote: One ug of each respective protein was mixed at a 1:1 ratio with 2X Laemmli buffer (Bio-Rad) which was supplemented with 2% β-mercaptoethanol (Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... 1 ug of mRNA was reverse-transcribed into cDNA using the iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA). RNA was hydrolyzed and re-suspended in nuclease free water ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ug of RNA was diluted into 15 uL reverse transcription reactions using the iScript RT kit (Bio-Rad) and reactions were carried out following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted using RNAeasy kit from Qiagen (#74104) and 1 ug of RNA was used to synthesize cDNA using iScript cDNA Synthesis Kit (#1708891) from BioRAD. qRT-PCR was performed using TaqMan universal PCR mix (#4324018 ...
-
bioRxiv - Cell Biology 2023Quote: ... 20-40 ug of protein was loaded per lane in a pre-cast gel for SDS-PAGE (Bio-Rad). Gel was then transferred using the TurboBlot Transfer (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... the indicated ESA supernatant was boiled in SDS-PAGE sample buffer and 3 μg of each sample was run with a 4-15% TGX gradient gel (Bio-Rad cat. no. 4561086), then transferred to a nitrocellulose membrane ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... genomic DNA was extracted using 250 mL of 5% Chelex 100 resin (Bio-Rad Laboratories, Hercules, CA) and 3 mL of proteinase K (20 mg/mL ...
-
bioRxiv - Plant Biology 2022Quote: ... USA (17) and a 1:3000 dilution of goat anti-rabbit IgG horseradish peroxidase (HRP) conjugate secondary antibody (Biorad). Chemiluminescence was detected using WesternBright ECL (Advansta ...
-
bioRxiv - Neuroscience 2019Quote: ... and samples were then transferred at 100 V at 4°C onto an activated 2 um polyvinylidene difluoride (PVDF) membrane (Bio-Rad 1620177), blocked with 3% BSA in 0.2% Tween-20 (Sigma P9614 ...
-
bioRxiv - Microbiology 2020Quote: ... or lacking (non-reducing) 100 mM β-mercaptoethanol and resolved by SDS-PAGE in a 4-20% Mini-PROTEAN TGX Precast Protein Gel (BIO-RAD). Proteins were transferred to nitrocellulose membranes using a Trans-Blot SD Semi-Dry Transfer Cell (BIO-RAD ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 μg of cell lysates were separated on a 4-20% resolving gel (Bio-Rad Mini-PROTEAN TGX Precast Gel #456-1094), transferred to a PVDF membrane for analysis using anti-FLAG (Sigma Aldrich #F3165 ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Plant Biology 2022Quote: ... A total of 3 ml of Ni2+- loaded resin was packed into Econo-Pac columns (cat. Number 7321010 – Bio-Rad) and equilibrated with 3 column volumes (CV ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant from the cell lysate was collected by centrifuging the cell lysate at 10,000 g for 10 min at 4°C and further diluted in lysis buffer to 8.0 ug/ul using a modified Bradford protein quantification assay (Bio-Rad), flash-frozen in liquid N2 ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were boiled with SDS-PAGE sample loading buffer (6X SDS) and 30 ug of protein was loaded to each well of a 10% Tris-glycine SDS-PAGE gel (BioRad). Proteins were transferred to a PVDF membrane (Millipore) ...
-
bioRxiv - Physiology 2023Quote: ... and left ventricle of wild-type C57 Bl6 mice was incubated with PC2 antibody (10 ug, Alomone laboratories) overnight complexed to magnetic protein G beads (Biorad). Following 3 rounds of washing ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2020Quote: ... The reconstitution sample was nutated for 1 h at 4°C before addition of 0.2 g/mL SM2-BioBeads (BioRad), and the reconstitution sample was further nutated overnight at 4°C before removal of the biobeads ...
-
bioRxiv - Biochemistry 2020Quote: ... The extracted protein (1000 mg) was loaded onto the 17 cm IPG gel strips (nonlinear, pH 3.0-10.0, Bio-Rad, USA) according to Chen et al (14) ...
-
bioRxiv - Bioengineering 2022Quote: 17 cytokines secreted from the HCCoC were analyzed using Bio-Plex Pro Human Cytokine Group-I Panel (M5000031YV, BioRad, CA). HCCoCs were exposed to physiological WSS for 6 hours after completion of the preconditioning protocol ...
-
bioRxiv - Physiology 2024Quote: ... T3 was extracted from supernatants and purified through solid-phase chromatography using 200 – 400 anion exchange chloride resin (Bio-Rad, 140-1251) in Poly-Prep chromatography columns (Bio-Rad ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A total of 100 μg brain lysate was run on a Bio-Rad Mini-Protean TGX 4-20% polyacrylamide gel (4561094, Bio-Rad, Hercules, CA) at 200V for approximately 40 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... and separated in polyacrylamide gels at 100-140 V on ice (4-15%, Mini-PROTEAN TGX, Bio-Rad; or as described previously [12]). To detect protein-bound acrolein in spinal cords ...
-
bioRxiv - Genetics 2023Quote: ... Co-IP reactions were rotated overnight at 4°C with 100 µl of SureBeads Protein G Magnetic Beads (BioRad; Catalog# 1614013; Hercules, CA). The bead lysates were washed five times in the co-IP buffer using a DynaMag Magnet (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4-15% Tris-HCI 4 SDS-PAGE gels (Bio-Rad), separated at 120V ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 ml of supernatant was diluted with 3 ml of distilled H2O and applied to freshly prepared Dowex columns (AG1-X8; Bio-Rad). Columns were washed twice with distilled H2O ...
-
bioRxiv - Molecular Biology 2023Quote: ... LAMP reaction products were analysed on 2% agarose gels (65V for 3 hr) stained with ethidium bromide (10 mg/mL) and viewed on Gel Doc XR Imaging System (BioRad, USA).
-
bioRxiv - Systems Biology 2020Quote: ... and used 500 ng - 1 ug RNA to make cDNA using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA). 0.1 of cDNA (i.e ...
-
bioRxiv - Plant Biology 2021Quote: ... ∼1 ug of RNA from resulting extraction was used as template in standard cDNA synthesis reaction (BioRad iScript cDNA Synthesis Kit). 200 ng of resulting cDNA was used in qRT-PCR reactions to quantify POL expression levels (PowerUp SYBR Green 5x Master Mix-Thermo) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The quality and concentration of the RNA was assessed and first strand cDNA synthesised from 1 ug using the iScript Select cDNA Synthesis Kit (Bio-Rad) and a 1:1 mixture of Oligo (dT ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 ug of protein from cortical samples and 45ug of muscle samples were diluted in 4x Laemmli sample buffer (Bio-Rad). P3 brain samples were already directly resuspended in 4x Laemmli sample buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 4-20% (BioRad), or 6% (Thermofisher ...
-
bioRxiv - Microbiology 2020Quote: ... Protoplast concentration was adjusted to 4 × 108 cells/ml and added to the same amount of 1.2% low melting agarose gel (Bio-Rad) solution ...
-
bioRxiv - Immunology 2024Quote: 96-well flat-bottom NUNC Maxisorp plates were coated overnight at 4 °C with 0.5 mg/mL recombinant HBsAg (BIO-RAD). Plates were washed with PBS/T ...
-
bioRxiv - Microbiology 2022Quote: ... reagent in 0.2 mL PCR 8-well strips and heated to 100 °C for 10 min (T100; BioRad, Australia) and used immediately ...