Labshake search
Citations for Bio-Rad :
1 - 50 of 10000+ citations for Synaptic Ras GTPase Activating Protein 1 Syngap1 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: Protein lysates (see “RAS activity assays”) were mixed with 4×Laemmli buffer (Cat.#161-0747; Bio-Rad Laboratories, Hercules, US) containing fresh 200 mM DL-Dithiothreitol (Cat.#3483-12-3 ...
-
bioRxiv - Microbiology 2022Quote: ... His6 tagged proteins were detected with anti-His6 primary antibody (Pierce; 1:6,000) and antimouse secondary antibody (Biorad; 1:10,000). GroEL was used as cytoplasmic control and detected as above ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: rat anti-myelin basic protein (MBP, 1:100, Bio-Rad antibodies MCA409S), mouse anti-myelin-associated glycoprotein (MAG ...
-
bioRxiv - Microbiology 2022Quote: ... His6 tagged proteins were detected with anti-His6 primary antibody (Pierce; 1:6,000) and anti-mouse secondary antibody (Biorad; 1:10,000). GroEL was detected with anti-GroEL primary antibody (Pierce ...
-
bioRxiv - Cancer Biology 2022Quote: ... proteins were probed with secondary antibodies goat anti-mouse-HRP (Bio-Rad, 1706516, 1:5000) or goat anti-rabbit-HRP (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were utilized: Rat Anti-Myelin Basic Protein (MBP; 1:500, Biorad) and Rabbit Anti-Oligodendrocyte transcription factor 2 (Olig2 ...
-
bioRxiv - Bioengineering 2024Quote: ... the membrane was incubated with HRP-conjugated anti-mouse secondary antibody (1:1000) and streptactin antibody (specific to the standard protein marker – Bio-Rad, Cat# 1610376; 1:1000 dilution) for 1 h at 25°C before washing it six more times ...
-
bioRxiv - Bioengineering 2023Quote: ... The membrane was then washed thrice for 5 mins in PBS-Tween 20 before incubation with an HRP-conjugated anti-mouse secondary antibody (1:1000) and streptactin antibody (specific to the standard protein marker – Bio-Rad, Cat# 1610376; 1:1000 dilution) for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... proteins were probed with either secondary antibodies goat anti-mouse-HRP (Bio-Rad, 1706516, 1:5000) or goat anti-rabbit-HRP (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... The samples and a protein ladder (a 1:1 mix of All Blue Prestained Protein Standards: Unstained Protein Standards; Precision Plus Protein™, Bio-Rad) were loaded to 4-15% mini-PROTEAN™ TGX Stain-Free™ Protein Gels (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins of interest were detected using HRP-conjugated secondary antibodies against mouse (1:7500, Bio-Rad Laboratories). The proteins were visualized using Amersham ECL Prime Western Blotting Detection Reagent (GE Healthcare).
-
bioRxiv - Molecular Biology 2020Quote: ... Protein-antibody complexes were collected by incubating protein extracts with 20 μl SureBeads Protein G magnetic beads (Bio-Rad) for 30 min at room temperature on a rocking shaker ...
-
bioRxiv - Biochemistry 2022Quote: ... h-Ras did not contain a HisTag and was purified on a Q-Sepharose column (Bio-Rad) in 20 mM Tris (pH 7.4) ...
-
bioRxiv - Plant Biology 2024Quote: ... antibodies and SureBeads Protein A magnetic beads (Bio-Rad) were used to immunoprecipitate NUP1:GFP at the NPC ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibody-bound DNA was recovered using the Protein A or Protein G magnetic beads (Bio-Rad), washed similarly as DRIP samples and treated with Proteinase K and RNAse after elution ...
-
bioRxiv - Neuroscience 2021Quote: ... secondary antibodies (1:10000; 1:50000 for anti-H3 antibody, BioRad) in 5% milk/PBST at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibodies (1:10000; 1:50000 for anti-H3 antibody, BioRad) in 0.1% Tween-20 in 1x PBS (PBS-T ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibodies (1:10000; 1:50000 for anti-Gapdh antibody, BioRad) in 5% milk/PBST at RT ...
-
bioRxiv - Microbiology 2022Quote: ... the samples were washed extensively with lysis buffer and the proteins were eluted by boiling 5 ul of the resin with 5x SDS loading buffer and the proteins were detected by western blot analysis using rabbit antibody to FLAG (1:2,000, BioRad) or mouse antibody to Myc (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... including unmodified antibodies and a protein ladder (Bio-rad, #1610375) were also used ...
-
bioRxiv - Genetics 2021Quote: ... Proteins were visualized using horseradish peroxidase-conjugated goat anti-rabbit secondary antibody conjugate (1:2000 dilution, Bio-Rad laboratories, #1706515) or horseradish peroxidase-conjugated goat anti-mouse secondary antibody conjugate (1:2000 dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were incubated with secondary antibody for 1 h and proteins were revealed by ECL Prime (Amersham) using ChemiDoc Touch imager (Biorad).
-
bioRxiv - Cell Biology 2023Quote: ... Additional antibodies used for the infected ALI cultures include: mouse anti-RSV Fusion protein (1:100, Cat# MCA490, Bio-Rad), rabbit anti-Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Microbiology 2024Quote: ... Immunoblotting was performed as described above in “Protein photocrosslinking and analysis” using anti-SNARE antibodies and Tidyblot (1:1000; BioRad) in 5% nonfat milk in TBST ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein was denatured with 1:1 Laemlli loading buffer (BIORAD) by boiling for 10 minutes on a dry bath (Thermolyne Dri-Bath ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... coli antibodies (1:100, Bio-Rad Antibodies, 4329-4906), followed by DyLight 650-conjugated donkey anti-rabbit IgG antibodies (1:1000 ...
-
bioRxiv - Biophysics 2022Quote: ... Samples (1 mg of protein per well) were loaded onto a protein gel (BioRad, 4-15% Criterion TGX Stain-Free Precast Gel) ...
-
bioRxiv - Microbiology 2021Quote: ... Bradford Protein Assay Reagents 1 and 2 and Precision Plus Protein All Blue Prestained Protein Standard were from Bio-Rad. The anti His-tag mouse antibody was from GenScript (cat no ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μl of recombinant proteins and 1 μl of a molecular weight marker (Precision Plus Protein Kaleidoscope Prestained Protein Standards, BioRad) were applied to the PAGE lane (10 wells ...
-
bioRxiv - Neuroscience 2020Quote: ... Depending on the primary antibody separated proteins were transferred to nitrocellulose (BioRad) or ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies were eluted from Protein G beads in chromatography columns (Bio-Rad) after centrifugation and washing with PBS using 0.1 M glycine (pH=3.0 ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies used in this study were anti-myelin basic protein (MBP, rat, monoclonal, clone 12, Bio-Rad, cat# MCA409S, 1:1000), anti-Neurofilament 200 (NF200 ...
-
bioRxiv - Cell Biology 2024Quote: ... The proteins were detected using chemiluminescence using horseradish peroxidase–conjugated secondary antibodies of anti-mouse (Bio-Rad # 170-6516, dilution 1:10,000) origin and enhanced chemiluminescence substrate (Thermo Scientific # 32106) ...
-
bioRxiv - Cell Biology 2022Quote: ... The proteins were detected using chemiluminescence using HRP conjugated secondary antibodies of either anti-mouse (Bio-Rad # 170-6516, dilution 1:10,000) or anti-rabbit (GE Healthcare # NA9340 ...
-
bioRxiv - Neuroscience 2022Quote: ... Beads were then transferred to fresh low- protein binding tubes and antibody-protein complexes were eluted by incubating in 60 μL 1x Laemmli Sample Buffer (Biorad, cat ...
-
bioRxiv - Immunology 2024Quote: ... In the case of purified protein 1 μg protein was loaded per condition and the Precision Plus Dual Color protein marker (Bio-Rad) was used as size standard ...
-
bioRxiv - Cell Biology 2024Quote: Proteins were detected by chemiluminescence following Western blotting using HRP conjugated secondary antibodies of anti-mouse (Bio-Rad # 170–6516; dilution 1:10,000), anti-rabbit (GE Healthcare # NA9340 ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were detected using HRP-conjugated antibodies and enhanced chemiluminesence reagent (Bio-Rad). Band intensities were quantified using ImageJ software.
-
bioRxiv - Immunology 2022Quote: ... antibodies bound to Protein G beads were eluted in chromatography columns (Bio-Rad) using 0.1 M glycine (pH=3.0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein bands were detected using Clarity Chemiluminescent HRP Antibody Detection Reagent (Bio-Rad) and visualized with a chemiluminescence reader (Fusion SL ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentration was measured using the Quick Start Bradford Protein Assay Kit 1 (Bio-Rad 5000201) in a Tecan Infinite F200 PRO spectrophotometer ...
-
bioRxiv - Genetics 2020Quote: ... and 1 mM EDTA) and protein concentrations were measured using the Protein Assay Kit (Bio-Rad). LPAAT activity was measured by incubating membrane fractions (containing 0.01 μg of protein ...
-
bioRxiv - Neuroscience 2022Quote: ... protein concentration was measured using the Quick Start Bradford Protein Assay Kit 1 (Bio-Rad 5000201) in a Tecan Infinite F200 PRO spectrophotometer ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentration was measured using the Quick Start Bradford Protein Assay Kit 1 (Bio-Rad 5000201) in a Tecan Infinite F200 PRO spectrophotometer ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentration was measured using the Quick Start Bradford Protein Assay Kit 1 (Bio-Rad 5000201) in a Tecan Infinite F200 PRO spectrophotometer ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentration was measured using the Quick Start Bradford Protein Assay Kit 1 (Bio-Rad 5000201) and a Tecan Infinite F200 PRO spectrophotometer ...
-
bioRxiv - Cell Biology 2021Quote: ... coli antibody (1:100, Bio-Rad), anti-LAMP1 (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein samples in 1× Laemmli sample buffer (Bio-Rad) were loaded and separated by 10% SDS-PAGE gels and then transferred to Immobilon-P membranes (Millipore) ...
-
bioRxiv - Immunology 2024Quote: ... ACPA IgG levels were quantified based on an in-house standard of pooled RA patient plasma using the Microplate manager software MPM-6 (Bio-Rad Laboratories, Inc.). Unspecific reactivity to the peptide backbone was assessed by applying CArgP2 ...