Labshake search
Citations for Bio-Rad :
1 - 50 of 218 citations for Sulfo NHS LC Biotin sodium since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2023Quote: ... using the ProteOn Amine Coupling Kit (EDC/NHS coupling chemistry, Bio-Rad) according to the respective manufacturer’s guidelines either on a ProteOn GLC sensor chip or a Series S CM5 sensor chip ...
-
bioRxiv - Immunology 2023Quote: ... Chelex 100 sodium resin (Bio-rad) was added to 4% (w/v ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... and unreacted Cy3B-NHS was removed via P2 gel (BIO-RAD, #150-4118) filtration in a Nanosep MF centrifugal device ...
-
bioRxiv - Immunology 2020Quote: ... diluted in 10 mM sodium acetate (BioRad), pH 5.0 ...
-
bioRxiv - Genomics 2023Quote: ... and anti-F4/80-biotin (clone A3-1, Bio-rad, MCA497BT) antibodies for 40 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Sodium dodecyl sulphate (SDS) electrophoresis grade from BioRad. Fructose ≥99% from Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... SDS (Sodium Dodecyl Sulfate) (Bio-Rad, Cat#1610302), Dulbecco’s MEM (DMEM) ...
-
bioRxiv - Biochemistry 2024Quote: ... diluted 1:25 in a mixture of 50% NanoGlo LCS buffer (BioRad # N206C) and 50% PBS ...
-
bioRxiv - Genetics 2019Quote: ... Migration of biotin-labeled probes was detected in the ChemiDoc MP Imager (BioRad) using streptavidin-horseradish peroxidase conjugates that bind to biotin and chemiluminescent substrate according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... buffer + 2% (v/v) Sodium dodecyl sulfate (SDS, Bio-Rad). Proteins were denatured at 95 °C and 600 rpm for 10 min before adding a final concentration of 2% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated biotin-NTPs were removed with RNase free P-30 columns (7326223; Bio-Rad), and three cycles of magnetic MyOne Streptavidin C1 bead purification (65002 ...
-
bioRxiv - Bioengineering 2020Quote: ... we first used a High Capacity cDNA Reverse Transcription Kit on a MyCycler (Bio-Rad, Hampton, NH, USA). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis (BioRad). Following gel electrophoresis ...
-
bioRxiv - Biophysics 2021Quote: ... The uncoupled BG-GLA-NHS was removed by filtration on Micro Bio-Spin™ P-6 Gel Columns (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA retro-transcription was performed using a High-Capacity cDNA Reverse Transcription Kit on a MyCycler (Bio-Rad, Hampton, NH). Next ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.1% (w/v) of sodium dodecyl sulfate (SDS, Biorad, catalog #: 1610302). Protein ladder was added (Biorad ...
-
bioRxiv - Microbiology 2019Quote: ... Lysates were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (Bio-Rad). Protein was transferred from the gel to a nitrocellulose membrane (Bio-Rad) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Sodium dodecyl sulfate (SDS) and PVDF membrane were procured from Bio-Rad. The protein ladder was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Biotinylated small RNAs were separated from HPDP-biotin and pyridine-2-thione using spin columns (BioRad) in ultra-pure water.
-
bioRxiv - Biophysics 2024Quote: ... The DNA strands at 1 mM concentration were incubated with 10 mM of BG-GLA-NHS and reactions were cleaned up using a Bio-Spin P-30 column (Bio-rad).
-
bioRxiv - Microbiology 2019Quote: ... and 1 mM sodium vanadate and equilibrated for protein content (Biorad assay kit). All lysates were resolved by SDS-PAGE electrophoresis and transferred to PVDF membranes ...
-
bioRxiv - Microbiology 2021Quote: ... Bound proteins were eluted into sodium dodecyl sulfate (SDS) sample buffer (Bio-Rad) containing 5% 2-mercaptoethanl (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... separated on a 4-15% sodium dodecyl sulfate/ polyacrylamide gel electrophoresis gel (BioRad) and transferred to a nitrocellulose membrane (BioRad) ...
-
bioRxiv - Immunology 2024Quote: ... Adherent cells were lysed in sodium dodecyl sulfate (SDS) sample lysis buffer (BioRad). Proteins were separated by gel electrophoresis on a 10% Tris-Glycine gel (BioRad) ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5% sodium deoxycholate) and 7.5uL of 4X Laemmli buffer (1610747; BioRad, Hercules, CA) and run on 10-20% Criterion Tris-HCl gels (3450042 ...
-
bioRxiv - Neuroscience 2024Quote: ... Urea and Sodium dodecyl sulfate (SDS) were purchased from Bio-Rad (Hercules, CA). Acetonitrile and water for nano-LC−MS/MS were purchased from J ...
-
bioRxiv - Neuroscience 2020Quote: ... These proteins were then subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (Bio-Rad) and transferred onto PVDF membranes (Bio-Rad) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Proteins (10-50 µg) were loaded onto 10% sodium dodecyl sulfate polyacrylamide gel (BioRad), separated by electrophoresis (SDS-PAGE) ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein was separated by 8%–12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (Bio-Rad) and blotted on polyvinylidene difluoride membrane (Merck Millipore) ...
-
bioRxiv - Microbiology 2023Quote: Sodium-Dodecyl-Sulphate (SDS) Polyacrylamide Gel Electrophoresis was done in precast gels (Bio-Rad TGX Mini-Protean 4-15% gels with Dual Colour Standard ...
-
bioRxiv - Immunology 2020Quote: ... Excess biotin was removed via size exclusion chromatography using an ENrich SEC 650 10 × 300 mm column (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... including CD44-bio (Miltenyi Cat#130-113-340) and an in-house biotin conjugation (Bio-Rad Laboratories, Cat#LNK262B) of anti-PSGL-1 and mouse IgG1 isotype control (R&D Cat#MAB002 ...
-
bioRxiv - Plant Biology 2021Quote: ... dissolved in a sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer (Bio-Rad) and separated on 15 % SDS-PAGE gels following the Laemmli method (Laemmli ...
-
bioRxiv - Neuroscience 2022Quote: ... A 12% sodium dodecyl sulfate-polyacrylamide gel was prepared according to manufacturer’s protocol (BIO-RAD). For the analysis 32 μl of the production supernatant was mixed with 8 μl 5xLaemmli buffer containing ß-Mercaptoethanol and incubated for 10 min at 95°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... miR-146a-loaded MLNPs were lysed with 0.5% sodium dodecyl sulfate (SDS) (BioRad, Hercules, CA), and loaded onto 2% agarose (Fisher BioReagents ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated in 4–15% sodium dodecyl sulfate/polyacrylamide gel electrophoresis gel (Bio-Rad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Immunology 2021Quote: ... Excess biotin was removed via size exclusion chromatography using an Enrich SEC 650 10 x 300 mm column (Bio-Rad). The S-2P probes were made at a ratio of 2 moles of trimer to 1 mole streptavidin ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant Bovine Interleukin-8 PBP039 and Goat anti Bovine Interleukin-8 Ab conjugated to biotin AHP2817B (all from Bio-Rad, protocol according to the manufacturer’s intructions).
-
bioRxiv - Immunology 2021Quote: ... Proteins were separated on a 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis precast gel (Bio-Rad), and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Physiology 2022Quote: ... and separated in an 4%–20% sodium dodecylsulfate (SDS) polyacrylamide gel system (Biorad, Hercules, CA, USA). After transfer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Thirty micrograms of protein were loaded onto sodium dodecyl sulfate−polyacrylamide gel for electrophoresis (Bio-Rad) and transferred onto PVDF membranes (Millipore ...
-
bioRxiv - Genetics 2021Quote: ... Total proteins were separated with 7.5% Mini-PROTEAN TGX sodium dodecyl sulfate polyacrylamide gel (Bio-Rad) with 20 µg of protein per lane ...
-
bioRxiv - Biophysics 2022Quote: ... washes and elutes were examined using SDS-PAGE (sodium dodecyl sulfate– polyacrylamide gel electrophoresis) (Gel: BioRad miniPROTEAN TGX AnyKD - 4569036 ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein lysates were separated using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE, Bio-Rad) and then transferred to nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Bio-Rad Laboratories, CA, USA) and transferred onto polyvinylidene difluoride membranes (Invitrogen ...
-
bioRxiv - Plant Biology 2020Quote: Gel based LC MS was performed on protein samples using 12% polyacrylamide gel via Bio-Rad Mini-Protean III equipment (Bio-Rad) at 50 V for 15 min followed by 200 V until 1 cm mark below the stacking gel as described by Valledor and Weckwerth (2014b) ...
-
bioRxiv - Immunology 2021Quote: ... were detected by staining membranes with anti-mouse IFNγ biotin (1mg/mL) (R46A2) followed by streptavidin-Alkaline Phosphatase (1mg/mL) and development with AP conjugate substrate kit (BioRad, UK). Spots were enumerated using an AID ELISpot reader and software (AID).
-
bioRxiv - Immunology 2021Quote: ... were detected by staining membranes with anti-mouse IFNγ biotin (1mg/mL) (R46A2) followed by streptavidin-Alkaline Phosphatase (1mg/mL) and development with AP conjugate substrate kit (BioRad, UK).
-
bioRxiv - Immunology 2021Quote: ... Proteins were also run on a sodium dodecyl sulphate (SDS) polyacrylamide gels (5–20% gradient; Bio-Rad) to check for purity39,40 ...