Labshake search
Citations for Bio-Rad :
151 - 200 of 4267 citations for Sheep Interleukin 6 IL6 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Beads SM-2 Resin and Bio-Gel P-6 were obtained from Bio-Rad Laboratories Inc ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Labeled probes were then purified using Micro Bio-Spin 6 Chromatography Column (BioRad, Berkeley, CA), and 1 μl of the probe was counted for subsequent radioactivity dilution calculations ...
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was diluted 1:6 and run with iTaq Universal SYBR Green Supermix (Bio-Rad) on ViiA 7 Real-Time PCR System according to manufacturer protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The modified probes were purified using a P-6 Micro Bio-Spin Column (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA probe was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad), denatured 5 min in 95°C and cooled on ice ...
-
bioRxiv - Immunology 2022Quote: ... using the magnetic rack (6-Tube SureBeads™ Magnetic Rack #1614916 BIORAD Hercules, CA, USA) to magnetized them ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were assessed using 6% polyacrylamide gel (made with 29:1 Acrylamide/Bis Solution, Bio-Rad) electrophoresis ...
-
bioRxiv - Genomics 2020Quote: ... The reaction was quenched with 2µl of 10mM EDTA and desalted with Microbio-spin 6 column (BioRad) to remove unincorporated nucleotides ...
-
bioRxiv - Biochemistry 2020Quote: ... The thiol-reduced protein was exchanged into anaerobic 0.5x TNG buffer using Microbiospin 6 columns (Bio-Rad). The protein concentration was determined by the Bradford assay (ThermoFisher scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Unconjugated dye was removed by passing the protein through Micro Bio-spin P-6 column (Bio-rad) equilibrated in GF150 buffer (25 mM HEPES (pH 7.4) ...
-
bioRxiv - Microbiology 2020Quote: ... separated on 6% acrylamide 8M urea gels and transferred to Zeta Probe GT membranes (Bio-Rad laboratories) by electroblotting ...
-
bioRxiv - Plant Biology 2019Quote: ... 5- to 6-week-old expanded leaves of Arabidopsis plants were bombarded with 1nm gold particles (BioRad) coated with pB7WG2.0-GFP and pB7WG2.0-RFPER ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein lysates (50µg) were loaded on a 6% SDS-PAGE gel and transferred to nitrocellulose membrane (BioRad) using a wet electroblotting system (BioRad) ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed with TBST (6 × 5 min) and developed using Clarity Western ECL Substrate (Bio-Rad, California, US). Images were captured with ChemiDoc XRS+ system (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA preparation involves coating 10 μl of .6 μm Gold microcarriers (1652262 Bio-Rad, Hercules, CA) with 1μg of purified DNA by gently vortexing DNA ...
-
bioRxiv - Immunology 2021Quote: ... IL-18 and IL-6 concentrations were measured using the Bio-Plex Pro Human Cytokine Assay (BioRad).
-
bioRxiv - Plant Biology 2022Quote: ... cumana KAI2d1-6 genes from parental lines and segregants using iProof High-Fidelity DNA Polymerase (BioRad #172530). The PCR products were then sequenced via MiSeq ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction mixture was desalted by twice passing through Micro Bio-spin 6 chromatography columns (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction mixture was desalted by twice passing through Micro Bio-spin 6 chromatography columns (Bio-Rad).
-
bioRxiv - Plant Biology 2023Quote: ... the treated protein was cleaned up using a Micro Bio-SpinTM P-6 Gel Column (BIO-RAD), and then they were further subjected to 5 mM sodium (meta ...
-
bioRxiv - Molecular Biology 2023Quote: ... then resuspended in 600 µl TNM100 buffer and transferred into Micro Bio-Spin 6 columns (Bio-Rad). The elution from IgG Sepharose beads was achieved by incubation with 30 µl homemade GST-tagged TEV protease for two hours on a shaking table at 16 °C.
-
bioRxiv - Microbiology 2023Quote: ... diluted 1:1,000 in 6% milk in PBS-T followed by α-mouse IgG HRP (Bio-Rad) diluted 1:5,000 in 6% milk in PBS-T ...
-
bioRxiv - Cancer Biology 2023Quote: 6-well culture plates were coated with 1 ml of 0.6 % Low Melt Agarose (Bio-Rad; 1613111). Cells were diluted at a density of 1.0 x 104 cells/ml in media containing 0.3% Low Melt Agarose and seeded 1 ml/ well ...
-
bioRxiv - Developmental Biology 2023Quote: ... and monitoring of mCherry expression after 6 and 22 h (ZOE fluorescent cell imager, Bio-Rad, 1450031).
-
bioRxiv - Immunology 2019Quote: ... Rosa26LSL-tdTomato/+ animals (6-12 weeks) were given 1 μg of FITC-conjugated rat anti-CD169 antibody (BioRad) diluted in a total volume of 20 μl of PBS into the right footpad to label CD169+ subscapular macrophages inside the draining LN ...
-
bioRxiv - Molecular Biology 2019Quote: ... 30 μL egg extract was applied to and eluted from a Micro Bio-Spin 6 column (Bio-Rad) equilibrated in ELB150 ...