Labshake search
Citations for Bio-Rad :
401 - 450 of 1025 citations for Recombinant Human Interleukin 3 Receptor Alpha Low Affinity His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was then incubated with HRP-conjugated anti-His monoclonal antibody (1:5000) and detected with supersignalfemto substrate (Thermoscientific, USA) using ChemiDoc imaging system (Bio-Rad laboratories, USA).
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Microbiology 2024Quote: ... and HopAM1 and C-terminal Flag-tagged IpaH4 were generated by PCR amplification using primers containing Flag sequences and flanking SacII / PacI off pIB/V5-His templates using iProof DNA polymerase (Bio-Rad; Table S4) and cloned into the pDGOpIE2 vector ...
-
bioRxiv - Physiology 2022Quote: ... Transfer Packs and protein transfer onto membranes was achieved using the low or mixed molecular weight (MW) preprogrammed protocol in a Trans-Blot Turbo transfer system (Bio-Rad). Membranes were blocked for 1 hour at room temperature in 5% milk or 5% BSA (Millipore Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... pH 9.0 running buffer and visualized using the FITC channel set at 100 µM resolution in low intensity mode on a GelDoc Pharos imager (BioRad Laboratories). ImageQuant software was used to analyse the fraction of probe bound in each lane and GraphPad Prism version 8 software was used to calculate the Kd ...
-
bioRxiv - Developmental Biology 2019Quote: ... Single cell qPCR was performed using the Fluidigm BioMark system on 96.96 Dynamic Array IFCs for Gene Expression using Delta Gene Assays and 2X SsoFast EvaGreen Supermix with low ROX (Bio-Rad). For data-processing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Single cell qPCR was performed using the Fluidigm BioMark system on 96.96 Dynamic Array IFCs for Gene Expression using Delta Gene Assays and Sso Fast EvaGreen Supermix with Low ROX (Bio-Rad). Single cell qPCR was performed using the Fluidigm BioMark system on 96.96 Dynamic Array IFCs for Gene Expression using Delta Gene Assays and 2X SsoFast EvaGreen Supermix with low ROX (Bio-Rad) ...
-
bioRxiv - Bioengineering 2020Quote: Organoids fixed in 4% w/v PFA and immunostained were embedded in 1% w/v low melting agarose (Bio-Rad Laboratories) solution and placed in an Eppendorf tube ...
-
bioRxiv - Microbiology 2019Quote: ... 100 μL of culture was removed through the septum using a sterile syringe and transferred to a trUVue low-volume cuvette (Bio-Rad) to read optical density at 600 nm using a SmartSpec Plus spectrophotometer (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2019Quote: ... gene expression analysis was achieved on the BioMark HD system (Fluidigm) using SsoFast EvaGreen Supermix with low ROX (Bio-Rad Laboratories) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: The purified baculoviruses were electrophoresed on 10% sodium dodecyl sulfate-polyacrylamide gel (BIOTOOLS) and transferred to a low-fluorescence polyvinylidene fluoride (PVDF) membrane (Bio-Rad) through Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... Infiltrated leaves were infiltrated with 100 µM D-luciferin and LUC activity was quantified after 48 h using a low-light CCD imaging apparatus (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... were separated on 12% (w/v) SDS-PAGE gels and transferred to an Immun-Blot low fluorescence-PVDF membrane (Bio-rad). The membrane was first blocked with Odyssey Blocking Buffer (TBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Pre-amplified cDNA was diluted at least 5-fold with nuclease-free water and mixed with SsoFast EvaGreen with Low ROX (BioRad #1725211) and chip-specific DNA Sample Reagents before loading into primed Flex Six or 96.96 Dynamic Array chips (Fluidigm #100-6308 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reactions were performed in 0.2ml non-skirted low profile 96 well PCR plates (Thermo Scientifi, #AD-0700) using a CFX Connect Real Time System thermo-cycler (Bio-Rad).
-
bioRxiv - Plant Biology 2023Quote: Lysate was filtered and applied to a 1 mL Mini Profinity IMAC cartridge using BioLogic low-pressure chromatography system (Bio-Rad). An imidazole gradient was used to elute the protein in elution buffer (300 mM imidazole ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Systems Biology 2020Quote: ... 50 mM DTT) and 3 mL oil (Biorad #1864006). After encapsulation ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Neuroscience 2022Quote: ... and analyzed with Opticon Monitor 3 and GeneX (BioRad) software ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed in 3% paraformaldehyde (Bio-rad) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Bioengineering 2019Quote: ... Lysate samples were analysed for recombinant protein expression by SDS PAGE (12% Mini-PROTEAN-TGX stain-free gel; Bio-Rad), using Precision Plus unstained protein ladder (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were analysed by Western Blot using custom-made SLR1 specific polyclonal antibody with Mini-Protean II system (Biorad).
-
bioRxiv - Biophysics 2022Quote: ... 2 μl of recombinant proteins and 1 μl of a molecular weight marker (Precision Plus Protein Kaleidoscope Prestained Protein Standards, BioRad) were applied to the PAGE lane (10 wells ...
-
bioRxiv - Biophysics 2023Quote: The monovalent streptavidin sample was kindly provided by the Howarth Lab (University of Oxford),23 and recombinant IgE Kappa (clone AbD18705_IgE, Cat#HCA190) was purchased from Bio-Rad Laboratories.
-
bioRxiv - Immunology 2024Quote: 96-well flat-bottom NUNC Maxisorp plates were coated overnight at 4 °C with 0.5 mg/mL recombinant HBsAg (BIO-RAD). Plates were washed with PBS/T ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...