Labshake search
Citations for Bio-Rad :
1 - 50 of 299 citations for Recombinant Human EIF2C1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant His-tagged proteins were purified using a 5 mL IMAC column (Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2023Quote: ... Strep-tagged recombinant (BioRad, 1610363). The gel image was acquired with ChemiDoc Imaging Systems (BioRad ...
-
bioRxiv - Physiology 2019Quote: ... 20x reference probe EIF2C1 labeled with HEX (BioRad), 5ng of DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... His-tagged recombinant protein was purified using Ni-NTA purification with the help of Ni-charged resins (Bio-Rad). Purified protein was further used for kinase assay ...
-
bioRxiv - Immunology 2023Quote: Purified recombinant His-tagged proteins were diluted to 0.5µg/ml in either Laemmli sample buffer alone (Bio-Rad, Hercules, CA, USA) or containing 50 mM dithiothreitol (DTT ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tagged protein was detected using a mouse anti-6×His IgG conjugated to horseradish peroxidase (MCA1396P; Bio-Rad), and the blot was developed using Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... Serially diluted recombinant human IgG1 or human IgG4 (BioRad, Hercules, CA) with unrelated specificities were used for quantification in separate wells on the same plate.
-
bioRxiv - Genetics 2023Quote: ... Reference assay for 3.1 kb deletion and 3.1 kb inversion assays: EIF2C1 refv3 (Bio-Rad, 10031279), Forward ...
-
bioRxiv - Plant Biology 2020Quote: ... The His-tagged fusion protein was purified using a Ni-NTA column (Bio-Rad, USA). Protein was eluted in elution buffer [500 mMNaCl ...
-
bioRxiv - Microbiology 2024Quote: ... Detection of His-tagged proteins was performed with the ClarityTM Western ECL substrate (Biorad, USA) and using a Versadoc (Biorad ...
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Immunology 2023Quote: ... Colorimetric (standards) and chemiluminescent detection (His-tagged proteins) were performed using the ChemiDoc Imager (Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... Gaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattct gcagacaaatggcagtattcatccacaattttaaaagaaaagggggg (FAM) The house keeping probe used for comparison was EiF2C1 (Assay ID: dHsaCP2500349 Cat: 10031243, BioRad).
-
bioRxiv - Biophysics 2022Quote: ... His-tagged σs was added to phosphorylated/unphosphorylated RssB in Micro Bio-Spin Chromatography columns (Bio-Rad) before removing 6μL of the input for SDS-PAGE analysis and adding 40μL of prepared HisPur Ni-NTA resin (Thermo Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged proteins in the cleared lysate were purified using Profinity™ IMAC Nickel Charged Resin (Bio-Rad) and eluted in 50 mM sodium phosphate buffer with 300 mM NaCl pH 8 and 300 mM imidazole (Fischer Scientific) ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-Rad using HuCAL technology ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-rad using the HuCAL technology ...
-
bioRxiv - Cancer Biology 2023Quote: ddPCR assays performed on cfDNA and EV-RNA were from Bio-Rad Laboratories Inc (ERBB2: dHsaCP1000116; dHsaCPE5037554, EIF2C1: dHsaCP2500349, EEF2: dHsaCPE5050049) and PCR reactions were run on T1000 thermal cycler (Bio-Rad, Hercules, CA, USA). Analysis of ddPCR data was analyzed using QuantaSoft Software ...
-
bioRxiv - Biochemistry 2021Quote: ... The recovery of tag-less MlaC was quantified using the ratio standard curve method (41) while that of His-tagged nanodisc-embedded complexes were quantified using the Lowry assay (DC Protein Assay, Bio-Rad). For retrograde assay ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Membranes were then washed 3 times with 1X TBST for 10 minutes each before being transferred to a solution containing enhanced chemiluminescence (ECL) substrate to allow visualization of His-tagged sfGFP (Bio-Rad). The blotted proteins were visualized in a ChemiDoc Imaging System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Pathology 2019Quote: ... Affi-gel 10 affinity resins were covalently cross-linked to his-tagged GT198 protein as antigen for affinity purification of anti-GT198 according to the manufacturer’s protocol (Bio-Rad, Hercules, CA). FFPE tumor sections or tumor microarrays were deparaffinized and dehydrated through xylene and ethanol series ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 1ng/ml recombinant human fibroblast growth factor (FGF) basic (BioRad, Veenendaal, The Netherlands) and 0.1mM L-ascorbic acid (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 1ng/ml recombinant human fibroblast growth factor (FGF) basic (BioRad, Veenendaal, The Netherlands) and 0.1mM L-ascorbic acid (Sigma Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... Mono-Mac-6 effector cells previously stimulated with recombinant human IFN-ɣ (Bio-Rad, Hercules, CA, USA; cat. PHP050) at 0.2 µg ml-1 for 3h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... mouse-anti His (BIO-RAD; MCA1396GA), mouse-anti p65 (F-6 ...
-
bioRxiv - Microbiology 2023Quote: ... A mouse anti-His antibody (Biorad) was used as a primary antibody in a 1:500 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP-tagged secondary antibodies (Bio-Rad, 1721011 and 1721019) were used in combination with Super-Signal ECL kit (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Rhodamine-tagged anti-actin (Bio-Rad #12004163; 1:10,000) was used as a loading control ...
-
bioRxiv - Plant Biology 2020Quote: ... 12.5 μL of SensiMix SYBR Hi-ROX (BIO-RAD) and DNAse/RNAse free water up to 15 μL ...
-
bioRxiv - Microbiology 2023Quote: ... and an anti-His-HRP conjugate antibody (Bio-Rad) was used in a 1:4000 dilution ...
-
bioRxiv - Microbiology 2023Quote: ... or His-tag antibody (MCA1396, Bio-Rad, 1:1000), or rabbit monoclonal β-actin antibody (D6A8 ...
-
bioRxiv - Bioengineering 2023Quote: ... The β-tubulin antibody was tagged with Rhodamine (Bio-Rad #12004166) and was imaged using Rhodamine channel in Chemidoc-MP as per manufacturer’s instruction.
-
bioRxiv - Molecular Biology 2023Quote: ... 6xHis-tagged LC8 was purified using Ni Profinity IMAC Resin (BioRad) followed by anion-exchange chromatography on HiTrap Q-HP column (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: ... mouse monoclonal His tag antibody (MCA1396GA, Bio-Rad, 1:1000), mouse 2A antibody (NBP2-59627 ...
-
bioRxiv - Microbiology 2023Quote: ... followed by incubation with mouse anti-His (1:1000, BioRad MCA1396GA) overnight at 4 °C and secondary antibody detection with IRDye800CW anti-mouse (1:5000 ...
-
bioRxiv - Microbiology 2024Quote: ... PorH-His immunoblots were performed on 16.5% tris-tricine gels (BioRad) using anti-His (mouse ...
-
bioRxiv - Microbiology 2022Quote: 6His-tagged proteins were affinity-purified using Gravity Flow Chromatography columns (Bio-Rad) loaded with 1-2 ml Ni-NTA agarose resin (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... serial dilutions of recombinant NS1 Antigen (Ag) (Bio-Rad) was used ...
-
bioRxiv - Plant Biology 2022Quote: ... Imaging was done using Hi-sensitivity chemiluminescence settings under ChemiDoc XRS+ (BioRad).
-
bioRxiv - Microbiology 2020Quote: ... T7-tagged templates were generated with the iProof High-Fidelity PCR Kit (Bio-Rad) using sequences cloned into plasmids pIB (LacZ) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant XRCC4-6xHis was immobilised on a GLC chip (BioRad Laboratories) in the vertical orientation ...
-
bioRxiv - Immunology 2019Quote: Lung homogenates and a pre-stained recombinant protein ladder (Bio-Rad) were run in a 12% SDS-polyacrylamide gel and were transferred to a nitrocellulose membrane (Bio-Rad) ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA) INSR - PrimePCR™ SYBR® Green Assay ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA). Resultant data was analysed using the proprietary LightCycler® Software 4.1 and Microsoft Excel ...
-
bioRxiv - Immunology 2020Quote: ... human CD68 (BioRad MCA5709), human ACE2 (Abcam ab15348) ...
-
bioRxiv - Neuroscience 2023Quote: ... the His-FUS proteins were mixed with Profinity IMAC Ni2+-charged resin (Bio-Rad) for 30 min at 20 °C ...
-
bioRxiv - Biophysics 2022Quote: ... His6-tagged proteins were purified using an Ni-NTA affinity column (Profinity IMAC Ni-Charged, BioRad).
-
bioRxiv - Immunology 2020Quote: Human plasma was analysed using the human 27-plex cytokine panel (Bio-Rad) according to manufacturer’s instructions and contained the following targets ...
-
bioRxiv - Microbiology 2019Quote: ... were coated with 1 μg/ml recombinant YFV NS1 (Biorad, cat # PIP052A) in 50 mM carbonate buffer (pH ...