Labshake search
Citations for Bio-Rad :
51 - 100 of 242 citations for Recombinant Human CD40 Fc Chimera since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Both sets of recombinant proteins were quantified using the Bradford protein quantification assay (Bio-Rad, UK).
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Immunology 2023Quote: ... to block Fc receptors and stained with biotinylated anti-mouse F4/80 (clone: Cl:A3-1, cat:MCA497B, BIO-RAD), PerCP-Cy5.5-conjugated streptavidin (551419 ...
-
bioRxiv - Biochemistry 2022Quote: ... The αM and β2 subunits of recombinant Mac-1 integrin were resolved on 4-20% polyacrylamide (BioRad), gradient gels by SDS-PAGE and stained with Coomassie brilliant blue R250 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel carrying the recombinant proteins and their derivatives was eventually stained with Coomassie Blue (Bio-Rad) for 1 hour and was de-stained with a de-staining solution (20% methanol and 10% acetic acid in water).
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant protein purities were assessed by SDS-PAGE using 4-20% Mini-Protean TGX gels (Bio-Rad, #4561094) and quantified using the BCA Protein Estimation kit (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... After quantifying the optimal virus-to-erythrocyte concentration (4HA units), serial two-fold dilutions of Fc, control IVIG (GammaGard, Baxter Healthcare) and polyclonal goat anti-influenza B (Biorad) were prepared ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... His-tagged recombinant protein was purified using Ni-NTA purification with the help of Ni-charged resins (Bio-Rad). Purified protein was further used for kinase assay ...
-
bioRxiv - Neuroscience 2024Quote: ... Imaging was performed using either an Odyssey Fc imaging system (Li-Cor) (quantified using Image StudioTM software) or a Molecular ChemiDocTM Touch Imaging System (Bio-Rad) (quantified using Image Lab 6.0.1 software).
-
bioRxiv - Bioengineering 2019Quote: ... Lysate samples were analysed for recombinant protein expression by SDS PAGE (12% Mini-PROTEAN-TGX stain-free gel; Bio-Rad), using Precision Plus unstained protein ladder (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were analysed by Western Blot using custom-made SLR1 specific polyclonal antibody with Mini-Protean II system (Biorad).
-
bioRxiv - Immunology 2021Quote: ... Recombinant Bovine Interleukin-8 PBP039 and Goat anti Bovine Interleukin-8 Ab conjugated to biotin AHP2817B (all from Bio-Rad, protocol according to the manufacturer’s intructions).
-
bioRxiv - Biophysics 2022Quote: ... 2 μl of recombinant proteins and 1 μl of a molecular weight marker (Precision Plus Protein Kaleidoscope Prestained Protein Standards, BioRad) were applied to the PAGE lane (10 wells ...
-
bioRxiv - Biophysics 2023Quote: The monovalent streptavidin sample was kindly provided by the Howarth Lab (University of Oxford),23 and recombinant IgE Kappa (clone AbD18705_IgE, Cat#HCA190) was purchased from Bio-Rad Laboratories.
-
bioRxiv - Immunology 2024Quote: 96-well flat-bottom NUNC Maxisorp plates were coated overnight at 4 °C with 0.5 mg/mL recombinant HBsAg (BIO-RAD). Plates were washed with PBS/T ...
-
bioRxiv - Cell Biology 2024Quote: ... the soluble fraction containing recombinant MBP-RON11-His6 protein was affinity purified twice on immobilized-metal affinity chromatography (IMAC) column using FPLC (Biorad) and further purified on CHT Ceramic Hydroxyapatite column ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Biochemistry 2022Quote: ... The soluble recombinant protein within the supernatant was purified and dialysed using the Profinia Affinity Chromatography Protein Purification System (Bio-Rad), with the mini profinity IMAC and mini Bio-Gel P-6 desalting cartridges (Bio-Rad) ...
-
bioRxiv - Microbiology 2019Quote: SDS-PAGE analysis of the recombinant TMPT2A (rTMPT2A) was performed on linear 12.5% polyacrylamide minigels in a Mini-Protean® Tetra cell system (BioRad, USA), as described by [22] ...
-
bioRxiv - Plant Biology 2022Quote: ... The purity of the recombinant protein was evaluated by SDS-PAGE and Coomassie staining (ChemiDoc Imaging System; BioRad, Hercules, CA, USA), and the concentration of the purified recombinant protein was determined with a Bio-Rad protein assay kit using bovine serum albumin (BSA ...