Labshake search
Citations for Bio-Rad :
201 - 250 of 5581 citations for Rat Tryptophan 2 3 Dioxygenase TDO2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... rat anti-CD68-Alexa Fluor 700 (1:50, BioRad, MCA1957A700), rat anti-Ter119-Super Bright 436 (1:100 ...
-
bioRxiv - Cell Biology 2024Quote: ... a rat anti-mouse CD206 primary antibody (Bio-Rad, USA), or a rat anti-mouse F4/80 primary antibody (Abcam ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... Absorbance of the suspension was measured at 570nm using ELISA plate reader (BioRad, USA). Cellular cytotoxicity was determined in duplicates and each experiment was repeated thrice independently.
-
bioRxiv - Immunology 2021Quote: ... The absorbance at 450 nm was measured by an ELISA plate reader (Bio-Rad). The endpoint serum dilution was calculated with curve fit analysis of optical density (OD ...
-
bioRxiv - Immunology 2023Quote: ... The plates were developed with TMB ELISA substrate solution (Bio-Rad Laboratories, Hercules, CA) and stopped using 1 N sulfuric acid ...
-
bioRxiv - Molecular Biology 2020Quote: ... The eluted fraction was precipitated with Ready Prep 2-D cleanup kit (Bio-Rad, USA). The precipitate was dissolved in O’Farrell lysis buffer and analyzed with 2D polyacrylamide gel electrophoresis ...
-
bioRxiv - Microbiology 2023Quote: ... then 2 µg were used to synthesize cDNA with the i-script kit (Bio-Rad). For standard range of clbB and cysG housekeeping gene (55) ...
-
bioRxiv - Cancer Biology 2019Quote: ... ScRNA-Seq libraries were prepared using SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina/Bio-Rad) according to manufacturer’s manual ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase activity was measured as described in the FAM FLICA caspase 1 and 3 kit (Bio-Rad, Hercules, USA). Lysosomal and mitochondrial content as well as production of ROS were analysed by staining with 50 nM LysoTracker™ Deep Red ...
-
bioRxiv - Neuroscience 2021Quote: ... The antibodies were rat anti-BrdU (1:500, MCA2060, Bio-Rad) or rabbit anti-GFAP (1:300 ...
-
bioRxiv - Immunology 2021Quote: ... rat anti-mouse CD68 (1:100, #MCA1957GA, Bio-Rad, Puchheim, Germany), hamster anti-mouse CD3e (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Immunohistochemistry was performed using rat anti-BrdU (MCA2060 GA, Bio-Rad), rabbit anti-Sp7/Osx (sc-22536-r ...
-
bioRxiv - Bioengineering 2020Quote: ... A FITC-conjugated rat anti-mouse CD204 monoclonal antibody (Bio-Rad) was prepared 1:200 in DMEM or CDMEM ...
-
bioRxiv - Bioengineering 2020Quote: ... Rat Anti-mouse CD68 (Biorad, MCA1957T, 1:200 dilution, 5μg/mL); Rabbit polyclonal anti-Histone-H2B (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μl primary rat anti-tubulin antibody (Bio-Rad AbD Serotec) at a 1:50 dilution in PBS/1%BSA was added and the slide incubated in a dark wet chamber at room temperature for 2 h ...
-
bioRxiv - Neuroscience 2022Quote: ... the primary antibody used was 1:100 CD68 (rat, Bio-Rad), and the secondary antibody was anti-rat Cy3 (Jackson Immunoresearch ...
-
bioRxiv - Immunology 2022Quote: ... rat anti-mouse F4/80 (BioRad, Cat# MCA497R, RRID:AB_323279, 1:50), rabbit anti-mouse Marco (Abcam ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CldU primary antibody (rat anti-BrdU, Biorad OBT0030S; Lot# 0109) or IdU primary antibody (mouse anti-BrdU ...
-
bioRxiv - Physiology 2020Quote: ... Anti F4/80 rat monoclonal (1:100; Bio-Rad, Hercules, CA) for macrophages ...
-
bioRxiv - Microbiology 2020Quote: ... The following antibodies were used: mouse anti-rat CD43 antibody (BioRad), rabbit polyclonal Surfactant C (Proteintech) ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-CD68 (1:200; MCA1957GA, Bio-Rad Company, United States), guinea pig anti-DCX (1:300 ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by Goat anti-rat IgG-HRP (1/5000, Bio-Rad), and rabbit α-PkNBPXa (1/5000) ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-Sn (1:300, catalog no. MCA947G; Bio-Rad Laboratories), hamster anti-CD11c (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD4 (1:1,000, catalog no. MCA1767; Bio-Rad Laboratories), rat anti-CD8 biotinylated (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD11b (1:100, catalog no. MCA74G; Bio-Rad Laboratories), rabbit anti-CD11b (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories); rabbit anti-MBP (1:300 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD11b (1:100, catalog no. MCA74G; Bio-Rad Laboratories); hamster anti- CD11c (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD206 (1:1000; Biorad, Hercules, CA, Catalog no. MCA2235GA), rat anti-Ki67 (1:500 ...
-
bioRxiv - Physiology 2023Quote: ... and rat anti-mouse cd68 (5 µg/mL, MCA1957, Bio-Rad) diluted in PTxwH buffer for 4 days ...
-
bioRxiv - Cell Biology 2023Quote: ... and rat anti-α-tubulin (1:2,000, MCA77G, Bio-Rad; RRID:AB_325003). The following secondary antibodies were used at a 1:400 dilution ...
-
bioRxiv - Immunology 2024Quote: ... Anti-F4/80 (rat anti-mouse MCA497A647, Biorad, dilution 1:500) and anti-Parp14 (sc377150 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies included rat-anti-CD13 (1:250, Bio-Rad; MCA2183EL), goat anti-CD31 (1:200 ...
-
bioRxiv - Biochemistry 2020Quote: To visualize protein expression 1 μL of the TXTL reactions was mixed with 2 μL of water and 3 μL of 2x Laemmli loading dye (Bio-Rad, Hercules, CA, USA) and incubated at 90°C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Pathology 2019Quote: ... this amount of protein was broken down via a precipitation and purification kit (ReadyPrep™ 2-D Cleanup Kit, Bio-Rad, Warsaw, Poland). The obtained protein pellets were then dissolved in a rehydration buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Measurement of serum cytokines was performed using multiplex ELISA (human 27-plex #m500kcaf0y, Bio-Rad).
-
bioRxiv - Immunology 2020Quote: Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
bioRxiv - Cell Biology 2020Quote: ... destained for 2 h at room temp (Coomassie Brilliant Blue R-250 staining kit, BIO-RAD), and imaged on a ChemiDoc MP (BIO-RAD).
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesised from 2 µg purified RNA using iScript™ cDNA Synthesis Kit (Bio-Rad) and quantified by qRT-PCR using iTaq™ Universal SYBR® Green Supermix ...
-
bioRxiv - Genetics 2022Quote: ... 1-2 μg RNA was used for cDNA synthesis using the iScript Advanced kit (Bio-Rad), following the manual.
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: The secretome samples were fractionated by one-dimensional SDS-PAGE with the Mini-protean® 3 kit (Bio-Rad, USA) using a 12% resolving gel and a 5% stacking gel at 200 V for 45 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... and rat an α-tubulin (1:1000; MCA78G; Bio-Rad AbD Serotec), polyclonal rabbit lamin B1 (1:300 ...