Labshake search
Citations for Bio-Rad :
201 - 250 of 6189 citations for Rat Interleukin 10 Receptor Beta IL10Rb ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... A FITC-conjugated rat anti-mouse CD204 monoclonal antibody (Bio-Rad) was prepared 1:200 in DMEM or CDMEM ...
-
bioRxiv - Bioengineering 2020Quote: ... Rat Anti-mouse CD68 (Biorad, MCA1957T, 1:200 dilution, 5μg/mL); Rabbit polyclonal anti-Histone-H2B (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μl primary rat anti-tubulin antibody (Bio-Rad AbD Serotec) at a 1:50 dilution in PBS/1%BSA was added and the slide incubated in a dark wet chamber at room temperature for 2 h ...
-
bioRxiv - Neuroscience 2022Quote: ... the primary antibody used was 1:100 CD68 (rat, Bio-Rad), and the secondary antibody was anti-rat Cy3 (Jackson Immunoresearch ...
-
bioRxiv - Immunology 2022Quote: ... rat anti-mouse F4/80 (BioRad, Cat# MCA497R, RRID:AB_323279, 1:50), rabbit anti-mouse Marco (Abcam ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CldU primary antibody (rat anti-BrdU, Biorad OBT0030S; Lot# 0109) or IdU primary antibody (mouse anti-BrdU ...
-
bioRxiv - Physiology 2020Quote: ... Anti F4/80 rat monoclonal (1:100; Bio-Rad, Hercules, CA) for macrophages ...
-
bioRxiv - Microbiology 2020Quote: ... The following antibodies were used: mouse anti-rat CD43 antibody (BioRad), rabbit polyclonal Surfactant C (Proteintech) ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-CD68 (1:200; MCA1957GA, Bio-Rad Company, United States), guinea pig anti-DCX (1:300 ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by Goat anti-rat IgG-HRP (1/5000, Bio-Rad), and rabbit α-PkNBPXa (1/5000) ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-Sn (1:300, catalog no. MCA947G; Bio-Rad Laboratories), hamster anti-CD11c (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD4 (1:1,000, catalog no. MCA1767; Bio-Rad Laboratories), rat anti-CD8 biotinylated (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD11b (1:100, catalog no. MCA74G; Bio-Rad Laboratories), rabbit anti-CD11b (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories); rabbit anti-MBP (1:300 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD11b (1:100, catalog no. MCA74G; Bio-Rad Laboratories); hamster anti- CD11c (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CD206 (1:1000; Biorad, Hercules, CA, Catalog no. MCA2235GA), rat anti-Ki67 (1:500 ...
-
bioRxiv - Physiology 2023Quote: ... and rat anti-mouse cd68 (5 µg/mL, MCA1957, Bio-Rad) diluted in PTxwH buffer for 4 days ...
-
bioRxiv - Cell Biology 2023Quote: ... and rat anti-α-tubulin (1:2,000, MCA77G, Bio-Rad; RRID:AB_325003). The following secondary antibodies were used at a 1:400 dilution ...
-
bioRxiv - Immunology 2024Quote: ... Anti-F4/80 (rat anti-mouse MCA497A647, Biorad, dilution 1:500) and anti-Parp14 (sc377150 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies included rat-anti-CD13 (1:250, Bio-Rad; MCA2183EL), goat anti-CD31 (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... and the primers for murine IFNAR 1 and beta-Actin in a MyiQ™ Single-Color Real-Time PCR System (BioRad). Products of RT-PCR were separated by electrophoresis on a 2.5% agarose gel in 1x TBE buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with beta-mercaptoethanol and denaturated at 95 °C for 5 min before loading on a 12 % PAA precast gel (#4561044, Bio-Rad). The gel was run at 70 V for 15 min and then 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... Measurement of serum cytokines was performed using multiplex ELISA (human 27-plex #m500kcaf0y, Bio-Rad).
-
bioRxiv - Immunology 2020Quote: Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was synthesized from 10 ng total RNA using the iScript cDNA synthesis kit (Biorad), quantitative real time PCR was performed on an ABI7900HT (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were loaded to 10% SDS-PAGE gels (TGX FastCast Acrylamide Kits, 1610183, Bio-Rad) and transferred to 0.45mm NC membranes (HATF00010 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Master mixes containing primer pairs against FIBCD1 or B2M (Beta-2-microglobulin, housekeeping gene) were prepared with iTaq Universal SYBR Green Supermix (Bio-Rad #1725122). The mastermixes were dispensed into each well containing cDNA and incubated on ice for 15 minutes to allow the cDNA to dissolve ...
-
bioRxiv - Physiology 2023Quote: ... 0.03% bromophenol blue) containing 9% beta-mercaptoethanol and separated by Mini-Protean TGX gel 4 - 15% (BioRad, stain-free gels #4568084, 4561035) and blotted onto Amersham Hybond-P PVDF membrane ...
-
bioRxiv - Cell Biology 2020Quote: ... and rat an α-tubulin (1:1000; MCA78G; Bio-Rad AbD Serotec), polyclonal rabbit lamin B1 (1:300 ...
-
bioRxiv - Immunology 2021Quote: ... slides were incubated in PBS with rat anti-CD8 (Bio-Rad, YTC182.20) plus either rabbit polyclonal anti-SARS-CoV-2 Spike/RBD (Sino ...
-
bioRxiv - Pathology 2022Quote: ... and rat monoclonal anti-F4/80 antibody (Bio-Rad Laboratories, Inc., MCA497GA). Vectastain ABC kit (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Tub1 (rat monoclonal anti-tubulin alpha, (Bio-Rad Cat# MCA77G, RRID:AB_325003)) (1:10000 dilution each in PBS-T) ...
-
bioRxiv - Neuroscience 2021Quote: ... the rat anti-mouse anti-IFN-γ antibody (Bio-Rad, Oxford, UK) and tyrphostin A47 (a tyrosine protein kinase [TPK] specific blocker ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-Myelin Basic Protein (BIO-RAD, reference MCA409S, 1/1000 dilution), rabbit anti-β-Tubulin III (Tuj1 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-CD68 (1:2,000, Bio-Rad, Hercules, CA; catalog no. MCA1957), rat anti-Lamp1 (1:4,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Following primary antibodies were used: anti-CD68 (rat 1:600, BioRad, MCA1957T), anti-Galactin1 (rabbit 1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were labeled with rat anti-CD68 (1:400, Bio-Rad MCA1957) or rat anti-MBP (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat monoclonal anti CD68 (clone FA-11, 1.4 ug/ml, Bio-Rad), rabbit polyclonal anti Iba-1 (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... Rat anti-F4/80 (Bio-Rad, clone CI:A3-1, #MCA497GA, 1:50), Rabbit anti-CD45 (Abcam ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a rat anti-F4/80 antibody (1/300, Bio-Rad, MCA497) to check astrocytic and microglial populations ...
-
bioRxiv - Cell Biology 2024Quote: ... and rat anti-α tubulin (YL1/2) (MCA77G, Bio-Rad; 1:1500). Secondary antibodies used were Alexa Fluor 488 goat anti-mouse IgG (H + L ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 3 μL of the resuspended membrane pellets containing the receptors were run alongside membrane pellet of uninjected oocyte on 4–15% precast gradient TGX Stain-Free™ gels (Bio-Rad Laboratories) for 34 min at 200 V ...
-
bioRxiv - Neuroscience 2020Quote: ... The amount of surface expressed receptors was detected by adding 60 µL wash buffer and 20 µL HRP substrate (Bio-Rad, 170-5060) per well ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal anti-MF20 (DSHB, Cat# MF 20, dilution 1:20) rabbit polyclonal anti-Calcitonin Receptor (Bio-RAD, Cat# AHP635, dilution 1:2000), chick anti-GFP (abcam ...
-
bioRxiv - Immunology 2022Quote: ... Optical density (OD) was immediately read at 450 nm using an ELISA plate reader (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 × 10 min with TBST and exposed with a ECL kit (Bio-rad, cat # 1705061) on X-ray films (Kodak ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein samples were mixed with LDS sample loading buffer at 4X concentration followed by addition of beta-mercaptoethanol (5%) (Bio-Rad, Hercules, CA). The resultant mixture was denatured at 95°C for 9 min ...
-
bioRxiv - Immunology 2019Quote: Mouse patellofemoral joints and hearts were homogenized using an electric homogenizer with toothed blades in tissue lysis buffer (Machery-Nagel, 740962) containing beta-mercaptoethanol (1:100) (Bio-Rad, 161-0710) and Triton-X-100 (1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... FITC-conjugated integrin β1 (CD29, HM beta 1-1, #MCA2298) and FITC-conjugated integrin β3 (CD61, #MCA2299) were from Bio-Rad (Oxford, UK). CHRONO-LUME® was from Chrono-log Corporation (Labmedics ...