Labshake search
Citations for Bio-Rad :
301 - 350 of 6654 citations for Rat Corticosteroid 11 Beta Dehydrogenase Isozyme 1 HSD11B1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and protein concentrations were equalized prior to boiling in the recommended sample buffers supplemented with 2.5% beta-mercaptoethanol (Bio-Rad). SDS-PAGE electrophoresis was performed using 4–12% gradient bis-tris gels (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... Absorbance of the suspension was measured at 570nm using ELISA plate reader (BioRad, USA). Cellular cytotoxicity was determined in duplicates and each experiment was repeated thrice independently.
-
bioRxiv - Immunology 2021Quote: ... The absorbance at 450 nm was measured by an ELISA plate reader (Bio-Rad). The endpoint serum dilution was calculated with curve fit analysis of optical density (OD ...
-
bioRxiv - Immunology 2023Quote: ... The plates were developed with TMB ELISA substrate solution (Bio-Rad Laboratories, Hercules, CA) and stopped using 1 N sulfuric acid ...
-
bioRxiv - Cell Biology 2022Quote: ... The reaction mixture (total volume 22 μl) contained 11 μl of 2× ddPCR Super Mix for Probes (BioRad, 1863024), 1.1 μl of 4 primers mixture 18 μM each ...
-
Impact of DNA sequences in the DNA duplex opening by the Rad4/XPC nucleotide excision repair complexbioRxiv - Biochemistry 2020Quote: ... The gels were quantitated by autoradiography using Typhoon FLA 9000 imaging scanner (GE) and Image Lab software (Version 5.2.1 build 11, 2014; Bio-Rad). The apparent dissociation constants (Kd,app ...
-
bioRxiv - Microbiology 2019Quote: ... The sample was then loaded onto 11 cm pH 3-10 immobilized pH gradient (IPG) strips (Bio-Rad 1632014) and rehydrated overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... Immunohistochemistry was performed using rat anti-BrdU (MCA2060 GA, Bio-Rad), rabbit anti-Sp7/Osx (sc-22536-r ...
-
bioRxiv - Bioengineering 2020Quote: ... A FITC-conjugated rat anti-mouse CD204 monoclonal antibody (Bio-Rad) was prepared 1:200 in DMEM or CDMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μl primary rat anti-tubulin antibody (Bio-Rad AbD Serotec) at a 1:50 dilution in PBS/1%BSA was added and the slide incubated in a dark wet chamber at room temperature for 2 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CldU primary antibody (rat anti-BrdU, Biorad OBT0030S; Lot# 0109) or IdU primary antibody (mouse anti-BrdU ...
-
bioRxiv - Microbiology 2020Quote: ... The following antibodies were used: mouse anti-rat CD43 antibody (BioRad), rabbit polyclonal Surfactant C (Proteintech) ...
-
bioRxiv - Physiology 2023Quote: ... and rat anti-mouse cd68 (5 µg/mL, MCA1957, Bio-Rad) diluted in PTxwH buffer for 4 days ...
-
bioRxiv - Immunology 2023Quote: ... The expression of immune system markers were mostly studied with inmunohistochemistry using the following antibodies: mouse anti rat CD68 (dilution 1:300 BIORAD, ref. MCA 341R) for monocytes/macrophages ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with beta-mercaptoethanol and denaturated at 95 °C for 5 min before loading on a 12 % PAA precast gel (#4561044, Bio-Rad). The gel was run at 70 V for 15 min and then 100 V for 1 h ...
-
bioRxiv - Plant Biology 2023Quote: ... and 10 (V/V) % beta-mercaptoethanol for 5 minutes before being loaded into a 4-20% gradient SDS-PAGE gel (Biorad: 4561096) and run according the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... Tissue lysates for Western blot were prepared as previously described [11] and sample protein content was determined by Bradford assay (BioRad). Lysates were loaded in 10% polyacrylamide gels and transferred to Immobilon membranes (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... An 11 kPa polyacrylamide (PA) solution (715 µL 50 mM HEPES pH 7.4, 150 µL 2% bis-acrylamide (Bio-Rad), 125 µL 40% acrylamide ...
-
bioRxiv - Molecular Biology 2019Quote: ... Measurement of serum cytokines was performed using multiplex ELISA (human 27-plex #m500kcaf0y, Bio-Rad).
-
bioRxiv - Immunology 2020Quote: Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Master mixes containing primer pairs against FIBCD1 or B2M (Beta-2-microglobulin, housekeeping gene) were prepared with iTaq Universal SYBR Green Supermix (Bio-Rad #1725122). The mastermixes were dispensed into each well containing cDNA and incubated on ice for 15 minutes to allow the cDNA to dissolve ...
-
bioRxiv - Physiology 2023Quote: ... 0.03% bromophenol blue) containing 9% beta-mercaptoethanol and separated by Mini-Protean TGX gel 4 - 15% (BioRad, stain-free gels #4568084, 4561035) and blotted onto Amersham Hybond-P PVDF membrane ...
-
bioRxiv - Immunology 2021Quote: ... slides were incubated in PBS with rat anti-CD8 (Bio-Rad, YTC182.20) plus either rabbit polyclonal anti-SARS-CoV-2 Spike/RBD (Sino ...
-
bioRxiv - Pathology 2022Quote: ... and rat monoclonal anti-F4/80 antibody (Bio-Rad Laboratories, Inc., MCA497GA). Vectastain ABC kit (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Tub1 (rat monoclonal anti-tubulin alpha, (Bio-Rad Cat# MCA77G, RRID:AB_325003)) (1:10000 dilution each in PBS-T) ...
-
bioRxiv - Neuroscience 2021Quote: ... the rat anti-mouse anti-IFN-γ antibody (Bio-Rad, Oxford, UK) and tyrphostin A47 (a tyrosine protein kinase [TPK] specific blocker ...
-
bioRxiv - Neuroscience 2022Quote: ... Used nest building material was removed from the cages and replaced by 11 g compressed extra-thick blot filter paper (Bio-rad). Every 24h for 5 days ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 µL of each diluted RT and NRT-PCR sample was added to a 22 µL reaction mixture containing 11 µL of QX200TM ddPCR TM Evagreen Supermix (Bio-Rad) and 1.1 µL of each 2 µM ddPCR primers (Table S3) ...
-
bioRxiv - Cell Biology 2022Quote: ... The OD595 for each strain was recorded at the beginning and end of an 11-h incubation period at 30°C using an iMark Microplate Absorbance Reader (Bio-Rad). A detailed outline of the SGA procedure is included in Table S4.
-
bioRxiv - Evolutionary Biology 2023Quote: The ddPCR reactions with a total volume of 22 μl were prepared as follows: 11 μl of 2x ddPCR Supermix for Probes (Bio-Rad), 900 nM of each primer (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2023Quote: The ddPCR reactions with a total volume of 22 μl were prepared as follows: 11 μl of 2x ddPCR Supermix for Probes (Bio-Rad), 900 nM of both primers (Sigma Aldrich ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The whole cell aliquot was resuspended in deionized water to achieve an OD600 nm of 11 and mixed with an equal volume of 2x Laemmli sample buffer (Biorad, CA). The whole cell samples were boiled at 95°C for 20 minutes and then centrifuged at 16,000 rpm for 10 minutes prior to gel loading ...
-
bioRxiv - Immunology 2022Quote: ... Optical density (OD) was immediately read at 450 nm using an ELISA plate reader (Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... The protein samples were mixed with LDS sample loading buffer at 4X concentration followed by addition of beta-mercaptoethanol (5%) (Bio-Rad, Hercules, CA). The resultant mixture was denatured at 95°C for 9 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... and rabbit F(ab’)2 anti-rat IgG conjugated to FITC (STAR17B, BioRad).
-
bioRxiv - Physiology 2023Quote: ... and goat anti-rat PE (50x stock concentration not reported, STAR73, Bio-Rad) diluted in PTxwH buffer ...
-
bioRxiv - Microbiology 2020Quote: ... 22 μL reactions contained 11 μL of 2x ddPCR™ Supermix for Probes (No dUTP) (Bio-Rad Laboratories, Inc., Cat. No. 1863023), 0.4 μM of all probes and primers ...
-
bioRxiv - Microbiology 2022Quote: ... rabbit polyclonal anti-nsP1 (both validated in our laboratory) [11] and mouse monoclonal anti-GAPDH (Cat. # VMA00046, Bio-Rad, Hercules, CA, USA). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... EV-derived cDNA samples (5.5 μl each) were mixed with 11 μl of 2X QX200™ ddPCR™ EvaGreen Supermix (Bio-Rad) and 5.5 μl of primers (35 nM each) ...
-
bioRxiv - Microbiology 2021Quote: ... Optical densities (OD) were measured at 450 nm using an ELISA plate reader (Spectrophotometer Bio-Rad Xmark). Cut-off values were assessed as the average OD plus two standard deviations obtained from serum (n = 100 ...
-
bioRxiv - Physiology 2023Quote: ... 18 and 21 months of age and were subjected to IEF using a 24 cm immobiline DryStrip (pH 6-11) (BIO-RAD, Hercules, CA), followed by SDS-PAGE using pre-casted 10-16% gradient polyacrylamide gels (BIO-RAD ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µL of each diluted RT and NRT sample was added to a 22 µL reaction mixture containing 11 µL of QX200™ ddPCR ™ Evagreen Supermix (Bio-Rad) and 1.1 µL of each 2 µM ddPCR primers (Table S6) ...
-
bioRxiv - Neuroscience 2020Quote: ... The rat monoclonal anti-tubulin antibody (AbD Serotec, Bio-Rad, Cat# MCA77G, RRID: AB_325003) recognizes the alpha subunit of tubulin ...
-
bioRxiv - Physiology 2021Quote: ... adipose tissues were stained with rat anti-F4/80 primary antibody (Bio-Rad, #MCA497B) and goat anti-rat HRP polymer (Cell IDX ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular proteins were detected using the rat monoclonal antibody anti-tubulin (MCA77G, Bio-Rad) diluted 1:3000 in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... oocytes were exposed to an anti-α-tubulin antibody (rat monoclonal MCA78G, Bio-Rad) overnight at 4°C and Alexa-Fluor-633-labelled goat anti-rat antibody (A-21094 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Collected sera were subjected to ELISA by capturing with human anti-rituximab idiotype antibody (HCA186, Bio-Rad Laboratories), detected with rat-anti-rituximab-HRP antibody (MCA2260P ...
-
bioRxiv - Microbiology 2019Quote: ... and plates were read 3 times at 450 nm in the model microplate ELISA reader (BIO-RAD, Japan). Negative controls (coated with naive sera ...
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...