Labshake search
Citations for Bio-Rad :
301 - 350 of 6095 citations for RGPD1 2 3 4 5 8 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Membrane blots were blocked with EveryBlot blocking buffer (Bio-Rad) for 10 min at room temperature ...
-
bioRxiv - Genetics 2022Quote: ... Membrane blots were blocked with EveryBlot blocking buffer (Bio-Rad) and probed with an anti-LC3B primary antibody (rabbit polyclonal ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in EveryBlot blocking buffer (BIO-RAD 12010020) for >5 min at room temperature and incubated with mouse anti-His antibody (Genscript A00186 ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked using a commercial blocking buffer (BIORAD) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked with EveryBlot Blocking buffer solution (Bio-Rad) for 5 minutes at room temperature according to the manufacturer’s instruction and hybridized with the primary antibody in the same blocking buffer overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were incubated with EveryBlot Blocking Buffer (Bio-Rad, 12010020) for 60 min at RT and were probed with anti-vinculin (Abcam ...
-
bioRxiv - Developmental Biology 2023Quote: ... The membranes were blocked with EveryBlot Blocking Buffer (Biorad, #12010020) for 10 minutes and incubated overnight at room temperature with primary antibodies diluted in EveryBlot Blocking Buffer at the indicated concentrations (Table S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was blocked with EveryBlot blocking buffer (BIO-RAD) for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked in EveryBlot Blocking Buffer (Bio-Rad 12010020) or 5% non-fat dry milk in TBST for 1 h then incubated overnight at 4°C in blocking buffer containing antibodies against TMEM106B (1:500 ...
-
bioRxiv - Microbiology 2024Quote: ... or β-actin rhodamine (Biorad,1:5000 in blocking buffer) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were blocked with every blot blocking buffer (Bio-Rad), incubated with primary antibody (∼1:1000 dilution in blocking buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... that were incubated in EveryBlot Blocking Buffer (Bio-Rad Laboratories) for 5 min at RT to block nonspecific binding ...
-
bioRxiv - Cell Biology 2022Quote: Equal volumes (5 µg) of the prepared co-IPs were separated by SDS-PAGE (4–15%, Bio-Rad) and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Physiology 2019Quote: ... qPCR was performed using Taqman probes for β-actin (assay #Mm02619580_g1) and MMP13 (assay #Mm00439491_m1 which targets exons 4-5) and using iQ SYBR Green Supermix (BioRad) with β-actin as the housekeeping gene (primer sequences given in Supp ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated 5 min at 95 °C and separated on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins could be detected with an infrared imager (Odyssey ...
-
bioRxiv - Molecular Biology 2023Quote: ... heated at 95°C for 5 min then run on a 4-12% Bis-Tris gel (BioRad 3450125). The input sample is identical to the initial solution containing protein in 60 μL 1x selection buffer prior to capture with 20 passages over the ME200 tip ...
-
bioRxiv - Neuroscience 2023Quote: ... with 5% β-Mercaptoethanol then loaded on 4-20% Criterion TGX Precast Midi protein gels (Bio-Rad #5671094). The gels were run in TGS buffer (1x ...
-
bioRxiv - Physiology 2022Quote: ... or 16.5% Criterion Tris-Tricine/Peptide gels (Bio-Rad) alongside two protein markers (Precision plus all blue and dual color standards ...
-
bioRxiv - Cell Biology 2021Quote: ... peptide was conjugated to Affi-gel resin (Bio-Rad) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture was then treated with 5% volume of Bio-Bead SM-2 resin (Bio-Rad) with shaking on ice for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% of the lysates were boiled with 2 x laemmli buffer (BIO-RAD, Hercules, CA, USA) and used as input ...
-
bioRxiv - Molecular Biology 2022Quote: ... boiled for 2 min and then analyzed on a 4–20 % SDS-PAGE gradient gels (Bio-Rad). The protein bands were then transferred to a nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2024Quote: ... Detergent removal was carried out at 4°C via incubation with Bio-Beads SM-2 (Bio-Rad) at a concentration of 200 mg ml-1 for three times with two hours for each time ...
-
bioRxiv - Plant Biology 2024Quote: ... centrifuged for 2 minutes before running through 4-20% mini Protean TGX Stain Free Gel (BioRad, USA). The separated proteins were transferred to Immobilon®-P PVDF membrane (Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... or at 100 V for 2 h at 4 °C using the wet transfer method (Bio-Rad Mini Trans-Blot Electrophoretic Cell 170-3930) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... which is pre-equilibrated by Buffer A before use with rotation at 3 hr in 4°C in Econo-Pac Chromatography Columns (20 mL, Bio-Rad). After the unbounded fraction was discarded ...
-
bioRxiv - Immunology 2020Quote: ... Samples were boiled for 3 min and sonicated for 30 s prior to loading on 4-20% Mini-PROTEAN TGX precast protein gels (Bio-Rad) and electrophoresis in Tris-glycine buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was run at 125 V for 3 to 4 hours and the RNA was then transferred to a Zeta-Probe GT membrane (Bio-Rad) by capillary action with 20 x SSC buffer (3 M NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Molecular Biology 2020Quote: ... samples were boiled for 5 min and equal volumes were loaded onto a 4-15% gradient gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Developmental Biology 2020Quote: ... the membrane was blocked overnight at 4°C using 5% non-fat dry milk (Bio-Rad, catalog 170-6404) in Tris-buffered saline pH 7.3 ...
-
bioRxiv - Neuroscience 2019Quote: ... ~5 μg of protein per lane was separated on 4-15% TGX gels (Bio-Rad Laboratories, Hercules, CA, USA) at 200V for 40 minutes in tris-glycine running buffer (Bio-Rad) ...
-
bioRxiv - Physiology 2021Quote: ... Samples (5 μL) were then loaded on precast gradients (4-15%) SDS-polyacrylamide gels in duplicate (Bio-Rad Laboratories) and subjected to electrophoresis at 180 V for 40 minutes using pre-made 1x SDS-PAGE running buffer (Ameresco) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... pH 8.3) running buffer by loading 5 μg sample onto 4-20% Mini-PROTEAN® TGXTM gels (Bio-Rad) with iBrightTM Prestained Protein Ladder (#LC5615 ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein samples were heated at 95°C for 5 minutes and 10µL were loaded on SDS-PAGE gels (4-20%Mini-PROTEAN TGX Stain-Free, BioRad). After electrophoresis ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µL of the supernatant was loaded into a 4−20 % Mini-PROTEAN-TGX gel (BioRad, Hercules, CA, USA), run at 165 V for 50 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg/sample was loaded onto 4-15% gradient polyacrylamide gels (Mini-PROTEAN TGX Gels, Bio-Rad, 4561083), transferred (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: ... Total protein (5∼15 µg) was loaded and separated by 4–20% pre-made SDS-PAGE gels (#4568095, BioRad, Mini-PROTEAN TGX Stain-Free Precast Gels ...
-
bioRxiv - Microbiology 2019Quote: ... Relative fluorescence was measured at 5-minute intervals for 2 hours in a CFX96 system (Bio-Rad).
-
bioRxiv - Developmental Biology 2019Quote: ... 2 μl of gene-specific primer pair and 5 μl iTaq Universal SYBR Green Supermix (Bio-Rad). The relative transcript abundance of each gene (normalized to rpl4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 μl cDNA (diluted 1:5) using a CFX384 real-time system qRT-PCR machine (BioRad). Primers were designed using Benchling and purchased from Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of diluted vRNP mixtures was loaded onto a 5% polyacrylamide native TBE gel (Bio-Rad) and run at 125 V for 80 min at 4°C ...