Labshake search
Citations for Bio-Rad :
1 - 50 of 2836 citations for RFamide Related Peptide 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed for the expression of the exosome production-related genes listed in Appendix Table 1 by RT-PCR on a CFX Connect Real-Time System (Bio-Rad Laboratories).
-
bioRxiv - Microbiology 2022Quote: ... and molecular weights were measured related to the proteins ladder (Precision PlusProtein All Blue Standards #1610373, Bio-Rad) using the Image Lab analysis software (Bio-Rad) ...
-
bioRxiv - Plant Biology 2020Quote: ... Endpoint analysis and allelic discrimination related to SNP calls were accomplished using the CFX96 Touch™software (BioRad, CA, USA). The DNA of the restorer line Primepi was used as a reference control for Rf3 (Geyer et al ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... and a rabbit anti-vasoactive intestinal peptide (1:500, catalog: 9535-0204, Bio-Rad). The secondary antibodies used in a study were as follows ...
-
bioRxiv - Plant Biology 2020Quote: Forward and reverse new PCR primers for the 12 Zn transport-related genes and the two reference genes suitable for SYBR® Green II RT-qPCR assays (Biorad, USA) were designed (Table 2) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The dried peptides were resuspended in deionized (dI) water for peptide estimation using Bradford’s assay (Bio-rad) (44).
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were probed for 1 hour at room temperature with 1:500 anti-XLF(New England Peptides, details in Methods under Immunodepletion) or 1:1000 anti-His (Bio-Rad MCA1396A) in PBST with 2.5% BSA ...
-
bioRxiv - Physiology 2022Quote: ... or 16.5% Criterion Tris-Tricine/Peptide gels (Bio-Rad) alongside two protein markers (Precision plus all blue and dual color standards ...
-
bioRxiv - Cell Biology 2021Quote: ... peptide was conjugated to Affi-gel resin (Bio-Rad) according to manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Glucagon-like peptide 1 (GLP-1) and Adiponectin were measured using quantitative Bio-Plex Pro™ Mouse Diabetes 8-Plex immunoassay (#171F7001M; Bio-Rad Laboratories, Hercules, CA, USA) and Bio-Plex Pro Mouse Diabetes Adiponectin assay #171F7002M (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2023Quote: ... Tryptic peptides were eluted off with spin columns (BioRad, 7326204) under a vacuum manifold ...
-
bioRxiv - Genetics 2021Quote: ... Dissolved peptide was coupled to Affi-Gel 10 resin (Bio-Rad) that had been washed 3 times in methanol ...
-
bioRxiv - Plant Biology 2022Quote: ... CLso mature effectors (without signal peptide) were amplified from haplotype A and B infected tomatoes genomic DNA under standard PCR conditions using iProof (Biorad, Supplementary Table 1). Annealing temperatures of primer pairs were calculated using FastPCR (Kalendar et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Peptide cleavage products were resolved on 10-20% Tris-Tricine gels (BioRad) and RNase 7 samples were resolved on 20% SDS-PAGE gels.
-
bioRxiv - Immunology 2023Quote: ... free peptides were removed using a Bio-Spin P-30 column (Biorad), leaving the labeled PTM tetramers in the flowthrough ...
-
bioRxiv - Molecular Biology 2019Quote: ... Eluting peptides were collected for 72 min using a BioFrac fraction collector (Bio-Rad). Fraction collection pattern was set to row and fraction collection size was set to 0.75ml ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was incubated with CcdA peptide (residues 46-72) coupled Affi-gel15 (Biorad) overnight at 4 °C ...
-
bioRxiv - Immunology 2022Quote: Excess Eα peptide was removed with Bio-spin 30 kDa size exclusion columns (Bio-Rad Laboratories) equilibrated with PBS according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoblot detection of 6xHIS and 2A peptide tags were determined through anti-Histidine tag (AD1.1.10, Biorad) and anti-2A peptide (3H4 ...
-
bioRxiv - Plant Biology 2020Quote: ... Peptide concentration was determined by a modified Lowry procedure using the DC Protein Assay (BioRad; Munich, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: Electrophoresis was used to separate peptides in a 16.5% Mini-PROTEAN® Tris-Tricine Gel (Bio-Rad) with tris-tricine (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... Supernatants were transferred to new tubes and peptide concentrations were quantified using the DC Protein Assay (Bio-Rad). Peptides were labeled using 10-plex TMT reagents as described above and 4 μg of proteins were used for each TMT channel ...
-
bioRxiv - Cancer Biology 2022Quote: ... Supernatants were transferred to new tubes and peptide concentrations were quantified using the DC Protein Assay (Bio-Rad). 50 μg of each sample were set aside for TMT labeling ...
-
bioRxiv - Cell Biology 2021Quote: ... The N-ter (pI 5.5) and C-ter (pI 9.9) peptides were conjugated to Affi-Gel-10 (Bio-rad) agarose beads for affinity-purification ...
-
bioRxiv - Cell Biology 2022Quote: ... 1.2 μl of the resuspended peptide was spotted on to a nitrocellulose membrane (BIO-RAD, 0.2 μm #162-0112) and left to air-dry ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Proteins and peptides bearing C-terminal 6xHis tags were detected with mouse anti-6xHis antibody clone AD1.1.10 (BioRad; Cat # MCA1396GA) while detection of glycosylated CRM197-FtO-PS was with anti-F ...
-
bioRxiv - Plant Biology 2019Quote: ... Purity and size of each peptide were determined by electrophoresis on a 4-20% Mini-Protean TGX gels (Bio-Rad). The correct mass of each peptide was confirmed by mass spectrometry prior to its use in experiments described below.
-
bioRxiv - Immunology 2020Quote: ... Cathepsin B activity was determined using Magic Red™ (a cell-permeable and non-cytotoxic reagent that contains a cathepsin B target sequence peptide (RR)2 linked to a red (Cresyl Violet) fluorescent probe) and lysosomes were detected with acridine orange (Biorad), according to manufactures instructions.
-
bioRxiv - Neuroscience 2021Quote: ... and vasopressin) peptides were spotted onto a 0.2-μm polyvinylidene fluoride membrane (Immun-Blot PVDF Membrane for Protein Blotting, BIO-RAD). The membrane was air dried at room temperature and was washed for 10 min in 0.05 M Tris buffer (pH 7.6 ...
-
bioRxiv - Genetics 2023Quote: The expression levels of non-ribosomal peptide synthetase genes were assessed using a real-time amplifier CFX96 (Bio-Rad, USA) and a commercial “PCR-mix SYBR Green I kit” (Syntol ...
-
bioRxiv - Bioengineering 2023Quote: We verified the conjugation of peptides to the ICBs following SDS-PAGE under reduced conditions using the Mini-PROTEAN Tetra system (Bio-Rad). The unmodified and peptide-conjugated ICBs were reduced to corresponding heavy and light chains of the Abs by incubating the formulations with 50 mM DTT for 10 min at 70 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Two µl of RLN3 peptide were added to the center of a 0.2 μm nitrocellulose membrane (Cat. No.1620146, Bio-Rad, Hercules, CA, USA). Non-specific sites were blocked by incubation with 5% BSA in Tris-buffered saline with 0.1% Tween® 20 detergent (TBS-T ...
-
bioRxiv - Developmental Biology 2019Quote: ... Gr-1 (1:500, MCA2387, Bio-Rad), Fluorescein labeled DBA-lectin (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... Xrn-1 digest samples were diluted 1:1 in 2X RNA loading dye (BioRad) and RNA was denatured at 80°C for 90 seconds ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was diluted 1:5 (for caecum 1:1 or 1:10) and qPCR was performed on a CFX384 Touch™ (Bio-Rad) with iTaq Universal SYBR (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... and F4/80 (Cl:A3-1, Bio-Rad, 1:1000) staining were performed by the Duke Pathology core (Durham ...
-
bioRxiv - Systems Biology 2023Quote: ... F4/80 (Bio-Rad, clone: Cl:A3-1, 1:80), TIM4 (BioLegend ...
-
bioRxiv - Microbiology 2024Quote: ... anti-WC-1 (Bio-Rad, MCA838GA, dilution 1:20) and anti-Pax5 (Agilent DAKO ...
-
bioRxiv - Physiology 2021Quote: ... and mixed 1:1 with 2x Laemmli buffer (Bio-Rad) plus 5% β-mercaptoethanol ...
-
bioRxiv - Pathology 2019Quote: ... F4/80 (Clone Cl:A3-1, Bio-Rad, MCA497R, 1:100), CD3 (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... The blot was stained with 1:1 enhancer:substrate reagents (BioRad) for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Each sample diluted 1:1 with Laemmli Sample Buffer (BioRad) mixed with 350 mM DTT ...
-
bioRxiv - Neuroscience 2022Quote: ... Each sample diluted 1:1 with Laemmli Sample Buffer (BioRad) mixed with 350 mM DTT ...
-
bioRxiv - Neuroscience 2022Quote: ... Each sample diluted 1:1 with Laemmli Sample Buffer (BioRad) mixed with 350 mM DTT ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein was denatured with 1:1 Laemlli loading buffer (BIORAD) by boiling for 10 minutes on a dry bath (Thermolyne Dri-Bath ...
-
bioRxiv - Biochemistry 2023Quote: ... The collected cells were mixed 1:1 with TrypanBlue (BioRad) and counted.
-
bioRxiv - Genetics 2023Quote: ... 1:500 to 1:1000 anti-rabbit (BioRad, 172-1019). Signal was detected using Pierce ECL Western Blotting Substrate (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... (BioRad Cl:A3-1) and goat anti-rat IgG cross-absorbed Alexa Fluor® 488 secondary antibody (ThermoFisher ...
-
bioRxiv - Biochemistry 2021Quote: ... Equal amounts (1 mg) of protein were diluted 1:1 in sample loading buffer (2x, Bio-Rad, UK) for each extraction method and loaded onto a 12% Tris-glycine pre-cast SDS gel (Invitrogen ...