Labshake search
Citations for Bio-Rad :
101 - 150 of 10000+ citations for Protein Detection since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... and visualized with ChemiDoc chemoluminescence detection system (Biorad). Quantification of Western blots by densitometry was performed using the Gel analyzer plug in from Image J ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Detection relied on EvaGreen chemistry (Bio-Rad, 1864034) and because the loading control (i.e ...
-
bioRxiv - Microbiology 2020Quote: ... run on the CFX96 detection system (Bio-Rad), with the following cycle conditions ...
-
bioRxiv - Genomics 2021Quote: ... Post auto-radiography using ECL detection reagent (BioRad), the membranes were washed with dH2O ...
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... Detection was performed on a ChemiDoc MP (Biorad) with Clarity Western ECL Substrate (Biorad ...
-
bioRxiv - Molecular Biology 2022Quote: ... Detection was with ECL reagent (1705061, Bio-Rad) on a Bio-Rad ChemiDoc imaging system (17001402 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Detection was with ECL reagent (1705061, Bio-Rad) on a Bio-Rad ChemiDoc imaging system (17001402 ...
-
bioRxiv - Cell Biology 2022Quote: Real-Time PCR Detection System (Bio-Rad Laboratories) using the following 3-step amplification protocol ...
-
bioRxiv - Pathology 2023Quote: ... before detection by Chemidoc XRS apparatus (Bio-Rad) and quantification by Quantity One software (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... on a CFX3384 PCR Detection System (Bio-Rad) using manufacturer’s recommended cycle parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... and visualized with ChemiDoc chemoluminescence detection system (Biorad). Quantification of Western blots by densitometry was performed using the Gel analyzer plug in from Image J.
-
bioRxiv - Biochemistry 2023Quote: ... using chemiluminescent detection of ChemiDoc XRS (Bio-Rad). β-Actin was used as the loading control.
-
bioRxiv - Cancer Biology 2024Quote: ... on a Real-Time PCR detection system (BioRad). Samples were analyzed in triplicate ...
-
bioRxiv - Bioengineering 2024Quote: ... ECL prime western blotting detection reagents (Bio-Rad) were used for chemiluminescence detection and imaged using BioRad gel doc.
-
bioRxiv - Cancer Biology 2024Quote: ... and IQ5 detection system (Bio-Rad, Hercules, CA). Relative gene expression was normalized to 36B4 or ACTB gene expression.
-
bioRxiv - Genetics 2024Quote: ... and an ECL detection kit (Bio-Rad Laboratories) according to the manufacturer’s protocol.
-
bioRxiv - Genetics 2024Quote: ... ECL prime western blotting detection reagents (Bio-Rad) were used at a ratio of 1:1 for chemiluminescence detection ...
-
bioRxiv - Microbiology 2020Quote: ... HRP activity was detected with a chemiluminescence detection system (Li-COR Imaging System) by using Clarity chemiluminescent detection system HRP substrate (Bio-Rad). Each Western blot also included 3 μL of a Page Ruler Plus pre-stained protein ladder (Thermo ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification and real-time fluorescence detection were performed on the iCycler real-time PCR detection system (Bio-Rad Laboratories, Hercules, Calif.). Positivity criteria of the assay required that a sample amplifies in both targets and below a set amplification cycle time (<38).
-
bioRxiv - Cancer Biology 2020Quote: ... Signal detection was done with HyGLO™ quick spray chemiluminescent HRP antibody detection reagent (Denville Scientific) and Chemidoc Touch Imaging System (BioRad) and quantified by ImageJ software.
-
bioRxiv - Cell Biology 2024Quote: ... Detection was performed by incubating the membranes with ECL Select Western Blotting Detection Reagent (GERPN2235 – Cytiva) for 3 minutes before detection using a ChemidocMP (Bio-Rad) or Alliance LD2 Imaging System (UviTec Cambridge).
-
bioRxiv - Immunology 2022Quote: ... Chemiluminescence detection was performed using the Amersham ECL Prime Western Blotting Detection System (Cytiva Amersham™) and a ChemiDoc Imager (Bio-Rad) with ImageLab software (version 6.0.1).
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were then subjected to peroxidase-based detection by using enhanced chemiluminescence (ECL) detection reagent (Clarity Max™ Western ECL Substrate, Bio-Rad), and the chemiluminescent signals were visualized by ChemiDoc Touch System (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad). Rpl19 mRNA levels were used for normalization and the ΔΔCt method (70 ...
-
bioRxiv - Bioengineering 2022Quote: ... Real-Time PCR Detection System (Bio-Rad Laboratories, California) was used to detect mRNA expression of target genes ...
-
bioRxiv - Cell Biology 2022Quote: ... on a CFX384 Real-Time PCR Detection system (Biorad). Expression of each gene was normalized to the housekeeping gene ALG9 and expressed as fold change after 1.5h rapamycin treatment calculated using delta-delta Ct method.
-
bioRxiv - Molecular Biology 2021Quote: ... and CFX384 Touch Real-Time PCR Detection Systems (BioRad). Relative levels of transcript expression were quantified by the comparative ΔΔCt method with normalisation to RPL19 levels ...
-
bioRxiv - Neuroscience 2019Quote: ... A CFX connect real-time detection system (Bio-Rad) was used to perform qPCR ...
-
bioRxiv - Immunology 2019Quote: ... The CFX384 TouchTM Real-Time PCR Detection System (BioRad) was used to obtain the raw CT values ...
-
bioRxiv - Systems Biology 2019Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad) were used for quantitative PCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... using CFX384 Real-Time PCR Detection System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... in CFX96TM Real-Time PCR Detection system (Bio-Rad). Ribosomal protein S14 (RPS14 ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: ... and a Real-Time PCR Detection System (Bio-Rad). The cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). Primer sequences are available upon request.
-
bioRxiv - Microbiology 2021Quote: ... using CFX96 Real-Time PCR Detection System (Bio-Rad) and 500 nM SARS-Cov-2 nsp1-specific CCTCAACTTGAACAGCCCTATG forward and GAATGCCTTCGAGTTCTGCTAC reverse primers.
-
bioRxiv - Biochemistry 2020Quote: ... for detection with the ChemiDocTM XRS+ System (Bio-Rad).
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were detected by ECL detection kit (Bio-Rad). ImageJ (NIH)-Fuji software were used to quantify the relative level of proteins.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The CFX96 Real-Time PCR Detection System (Bio-Rad) was used to monitor fluorescent intensity during amplification ...
-
bioRxiv - Plant Biology 2021Quote: ... in a CFX96 Real-Time Detection System (Bio-Rad), using 1 μL of cDNA in a final reaction volume of 10 μL per well ...
-
bioRxiv - Cell Biology 2021Quote: ... Blots were imaged using Western Clarity detection reagent (BioRad) before detection on a BioRad Chemi Doc imaging system with BioRad Image Lab v5.1 software.
-
bioRxiv - Cell Biology 2021Quote: ... and a colorimetric detection kit (BioRad, Hercules, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... Detection was performed with ECL (Bio-Rad or Thermo), and images were acquired with a ChemiDoc XRS imaging system (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... in iQ5 Real-Time PCR Detection System (Bio-Rad). A portion of the m-hCDKL5 (Fw 5’-CTTAAATGCAGACACAAGGAAACAC-3 ‘ ...
-
bioRxiv - Microbiology 2020Quote: ... on CFX96 TouchTM Real-Time PCR Detection System (BioRad). The genome sequence of P ...
-
bioRxiv - Cancer Biology 2020Quote: ... on the CFX384 RT-PCR detection system (Bio-Rad). Isoform-specific primers sequences and housekeeping gene primers are shown in the Supplement Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and imaged using the detection solution (BioRad, 170-5061) and ChemiDoc imaging system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... The CFX Connect Real-Time PCR Detection System (BioRad) was used to run RTq-PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... Bands were visualized using enhanced chemiluminescence detection kit (BioRad). Images were acquired using a Fusion FX imaging chamber (Vilber).
-
bioRxiv - Molecular Biology 2022Quote: ... and a Real-Time PCR Detection System (Bio-Rad). Bacterial strains were grown for 2 hours at 37°C under inducing conditions in LB ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...