Labshake search
Citations for Bio-Rad :
151 - 200 of 6264 citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... the plate was sealed with adhesive optical plate sealing film (Microseal, Bio-Rad) and placed in a Synergy H1 microplate reader (BioTek ...
-
bioRxiv - Genomics 2020Quote: ... The plate was heat sealed with the PX1 PCR Plate Sealer (Bio-Rad) and subsequently placed in the C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The plate was sealed with adhesive optical plate sealing film (Microseal, Bio-Rad) and placed in a Synergy H1 microplate reader (BioTek ...
-
bioRxiv - Microbiology 2023Quote: ... The sample plate was heat-sealed on a PX1 PCR plate Sealer (BioRad) and thermocycling was performed on a C1000 Touch with a Deep Well Reaction Module (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... the plate was heat-sealed using the PX1 PCR Plate Sealer (BioRad #1814000) and PCR was performed with a pre-step of 95 C for 5 minutes followed by 40 rounds of amplification with 60C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Measurement of serum cytokines was performed using multiplex ELISA (human 27-plex #m500kcaf0y, Bio-Rad).
-
bioRxiv - Immunology 2020Quote: Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCRs were performed in 384-well plates (Bio-Rad white hard-shell plate #hsp3805) in a final volume of 10 µl ...
-
bioRxiv - Molecular Biology 2019Quote: ... using 96-well plates (Hard-Shell® 96-Well PCR Plates, #hsp9601, Bio-Rad). The following thermal cycling program used was ...
-
bioRxiv - Microbiology 2021Quote: ... The plate was subsequently loaded into the QX200 Plate Reader (Bio-Rad, IL USA) and data was analysed using the QuantaSoft Software (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... Each plate was sealed using a Microseal “F” PCR plate seal (Bio-Rad, #MSF1001) and stored at −80°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plates were firmly sealed with Microseal ’B’ PCR Plate Sealing Film (Bio-Rad MSB1001), mixed several times by inversion and low-intensity vortexing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Complementary DNA (cDNA) was synthesized with 1-5 μg of RNA using iScript cDNA synthesis kit (Bio-Rad). mRNA levels were measured using qRT-PCR with SYBR Green Master Mix (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... Oligo-dT first strand cDNA were synthesized from 5 μg total RNA by iScriptAdv cDNA kit (Biorad, # 1725038) following the manufacturers recommendations ...
-
bioRxiv - Genomics 2021Quote: ... Plates were sealed (BioRad, MSB1001), centrifuged for 1 min at 2000 rpm and incubated at 42 C on a ProFlex PCR system (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... thin-wall PCR plate (BioRad). Amplification was performed using a CFX96 Touch Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Biochemistry 2021Quote: ... using 96-well plates (Hard-Shell® High-Profile Semi-Skirted PCR Plate, BIO-RAD) and a 25-µL total volume for each reaction ...
-
bioRxiv - Genetics 2019Quote: ... Plates were sealed with a Microseal B adhesive plate seal (Bio-Rad, Hercules, CA, USA) and incubated for 10 min at 55°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... in either 96 well plates or 384 well plates using either CFX 96 (Bio-Rad) or CFX Opus 384 (Bio-Rad ...
-
bioRxiv - Systems Biology 2022Quote: ... Drugs were then added to the plates and protein was harvested after 2 hours using the Bio-Plex Pro Cell Signaling Reagent Kit (BioRad 171304006M) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative PCR reactions and measurements were performed with a CFX384 Real-Time PCR detection system or an iQ5 Multi-color real-time PCR detection system (Bio-Rad, Hercules, CA, USA) using the SYBR Green Fluorescein Mix (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Forty µg denatured protein per well was resolved by 8-12% SDS- PAGE homemade gels in parallel with multi-colored molecular weight marker (Bio-Rad Laboratories, Cat.No.1610395). Gels were run at 100V for 1-2 h and transferred overnight at 8- 12V ...
-
bioRxiv - Neuroscience 2020Quote: ... Thin-wall PCR plates (#HSP9601) and Microseal optical plate covers (#MSB1001) were from BioRad (Hercules, CA). Trizol Reagent (#15596026 ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR reactions were undertaken in 96-well optical reaction plates (Bio-Rad Hard Shell PCR Plates). A 20 µl PCR reaction was set up in each well using the SYBR PowerUp Green Master Mix (Applied Biosystems ...
-
bioRxiv - Physiology 2021Quote: ... the plate was immediately placed in a plate reader at 30°C (xMark-Microplate; Bio-Rad), and after 30 s of linear agitation ...
-
bioRxiv - Cell Biology 2022Quote: ... using PX1 PCR plate sealer (BioRad). The optimized PCR thermal cycling was conducted on a conventional PCR machine (BioRad ...
-
bioRxiv - Neuroscience 2020Quote: ... using 96 well plates (Bio-Rad). The amplification started with an initial denaturation step at 95°C for 5 min ...
-
bioRxiv - Bioengineering 2022Quote: 96-well PCR plate (Biorad, HSP9631)
-
bioRxiv - Immunology 2024Quote: ... Microseal ‘B’ plate sealers (Bio-Rad) and iTaq Universal Probes Supermix (Bio-Rad Laboratories) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plates were sealed (Bio-Rad MSB1001) and both sfGFP fluorescence (emission/excitation ...
-
bioRxiv - Genetics 2023Quote: ... Plate Sealing Film (Bio-Rad, MSB1001) and Bio-Rad C1000 Touch Thermal Cycler were used for qPCR experiments ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: Aliquots of the samples were organized in a 96well PCR plate and reverse transcribed to cDNA using the iScriptTM Reverse Transcription Supermix kit and protocol (BioRad; Hercules, CA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... In this assay chemiluminescent reagent was used and the image of spots was captured using a Flour-S Max Multi-imager (Bio-Rad Laboratories, Hercules, CA, USA), and the spot density was determined with Quantity One Software (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary antibody was washed away 5× with TBS-T and developed with an AP Conjugate Substrate Kit (Bio-Rad). Spots were quantified using a Nikon ELISPOT system and NIS-Elements AR software (v ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the protein concentrations of the supernatants were determined using DC™ Protein Assay Kit (Bio-Rad #5 000 112). Equal concentrations of protein (30 μg ...
-
bioRxiv - Microbiology 2022Quote: ... and transferred into a 96-well PCR plate (heat-sealed with a foil plate seal, Bio-Rad). PCR was carried out in a C1000 thermal cycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... thin walled plates 384-well PCR Plate (ABgene 12164142) by using SYBR Green Supermix (Biorad, 172-5124), 10% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The plates were washed using a 96-well plate magnetic handheld washer from Bio-Rad (NSW, Australia). The Bio-Plex Manager 3.0 software was used to operate the system and interpret the data.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... Collected sera were subjected to ELISA by capturing with human anti-rituximab idiotype antibody (HCA186, Bio-Rad Laboratories), detected with rat-anti-rituximab-HRP antibody (MCA2260P ...
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplicates of each sample were run per plate (Hard-shell PCR Plates 96 well, thin wall; Bio-Rad), which were sealed with Microseal ‘B’ Seals (BioRad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplicates of each sample were run per plate (Hard-shell PCR Plates 96 well, thin wall; Bio-Rad), which were sealed with Microseal ‘B’ Seals (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification reactions of each DNA sample were performed in PCR plates (hard-shell PCR plate, #HSP9645; Bio-Rad), in a volume of 25 μl containing 12.5 μl PCR buffer (HotstarTaq mastermix ...
-
bioRxiv - Cell Biology 2022Quote: ... Up to 5 μg of total RNA was reverse transcribed into cDNA using iScriptTM Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad). Quantitative real time-PCR was performed using GoTaq® qPCR Master Mix (Promega ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-CD63 and anti-CD81 detection antibodies (supplied in the MACSPlex kit, 5 µl each) or anti-decoy receptor antibodies (AlexaFluor647-labelled anti-human TNFR1, Bio-Rad, cat #MCA1340A647 ...