Labshake search
Citations for Bio-Rad :
101 - 150 of 2697 citations for Primary Human Brain Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Neuroscience 2020Quote: EV samples and brain tissue homogenate samples were run in a 4% to 20% gradient gel (# 4561093 Bio-Rad) and electro-transferred to Immobilon-P membrane ...
-
bioRxiv - Neuroscience 2023Quote: PFA fixed brain samples were incubated in 1% hydrogel monomers (HMs) consisting of 1% w/v acrylamide (#1610140, BioRad), 0.05% w/v bisacrylamide (#1610142 ...
-
bioRxiv - Neuroscience 2023Quote: ... Reverse transcription was performed using 350 ng (CD11B+) and 1,000 ng (brain) mRNA with an iScript cDNA synthesis kit (BioRad). Real-time quantitative PCR was performed on triplicate samples using SYBR Green Supermix (BioRad) ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
bioRxiv - Immunology 2019Quote: ... For detection of primary antibodies anti-rabbit-HRP (170-6515, BioRad), and anti-mouse-HRP (170-6516 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μl primary rat anti-tubulin antibody (Bio-Rad AbD Serotec) at a 1:50 dilution in PBS/1%BSA was added and the slide incubated in a dark wet chamber at room temperature for 2 h ...
-
bioRxiv - Neuroscience 2022Quote: ... the primary antibody used was 1:100 CD68 (rat, Bio-Rad), and the secondary antibody was anti-rat Cy3 (Jackson Immunoresearch ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CldU primary antibody (rat anti-BrdU, Biorad OBT0030S; Lot# 0109) or IdU primary antibody (mouse anti-BrdU ...
-
bioRxiv - Cell Biology 2020Quote: ... The primary antibody binding was processed for ECL detection (Bio-Rad) with appropriate HRP-conjugated secondary antibodies (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-canine distemper virus nucleoprotein mouse monoclonal primary antibody (Biorad) in selected fox tissues.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The primary antibodies are listed as follows: CD68 (Bio-Rad, MCA341GA), CD206 (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies included rat-anti-CD13 (1:250, Bio-Rad; MCA2183EL), goat anti-CD31 (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies used were mouse anti-PLP1 (Biorad #MCA839G; 1:250) and goat anti-PDGFRα (R&D Systems #AF1062 ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein concentrations of brain lysate and myelin fractions were determined using the DC Protein Assay Kit (Bio-Rad, Munich, Germany) following the manufactureŕs instruction and measured using the EonTM High Performance Microplate Spectrophotometer (BioTek ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentrations of brain lysate and myelin fractions were determined using the DC Protein Assay Kit (Bio-Rad, Munich, Germany) following the manufacturer’s instruction and measured using the Eon High Performance Microplate Spectrophotometer (BioTek ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations of brain and olfactory extracts were determined using the RC DC Protein Assay kit (Bio-Rad, Hercules, CA) as described (Miller et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μl of brain homogenate from each sample was analyzed for protein concentration using BioRad protein assay reagent (BioRad, Hercules, CA). 1 μl of 0.2 M perchloric acid per sample was added to the remaining homogenate and was centrifuged at 10,000 rpm for 10 minutes at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: RT-qPCR was performed on 10 brains per genotype (WT and ywhaz-/-) with three replicates for each brain using a CFX ConnectTM Real-Time System machine (BioRad Laboratories), the SensiFASTTM SYBR No-ROX Mix (Bioline) ...
-
bioRxiv - Cell Biology 2023Quote: ... for protein extracted from cultured cells or brain sections and micro bicinchoninic acid (microBCA) for protein extracted from EVs according to the manufacturer’s instructions (Bio-Rad Laboratories).
-
bioRxiv - Biochemistry 2020Quote: ... the membrane was incubated with mouse anti-WIPI2b primary antibody (BioRad, MCA5780GA) used at a dilution of 1:1000 in 3% milk/TBST (0.1% Tween20) ...
-
bioRxiv - Cell Biology 2020Quote: Primary FBs were lysed in 1x Laemmli Buffer (Bio-Rad Laboratories, Inc.) and loaded on 4-15% SDS-PAGE gels (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... blots were incubated with primary antibodies (Monoclonal Mouse anti-β-Actin, BioRad, Cat ...
-
bioRxiv - Cell Biology 2022Quote: The following primary antibodies were used: anti-β-actin (#MCA5775GA, Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2020Quote: ... The sections were then incubated with primary antibodies against CD68 (Bio-Rad) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... Depending on the primary antibody separated proteins were transferred to nitrocellulose (BioRad) or ...
-
bioRxiv - Immunology 2022Quote: ... hFAB Rhodamine anti-GAPDH primary antibody (Bio-Rad, cat. 12004168, 1:10,000).
-
bioRxiv - Immunology 2021Quote: ... Primary MBECs were seeded on coverslips pre-coated with 0.1 % gelatin (BioRad). Fixation and permeabilisation steps were carried out as for DCs ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies were detected using horseradish-peroxidase conjugated anti-rabbit antibodies (BioRad) and detected with Western Lightning ECL reagents.
-
bioRxiv - Neuroscience 2023Quote: ... Following primary antibodies were used: anti-CD68 (rat 1:600, BioRad, MCA1957T), anti-Galactin1 (rabbit 1:200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies were diluted in 5% milk (Bio-Rad, Hercules, CA, USA) in TBST ...
-
bioRxiv - Systems Biology 2023Quote: ... The following primary antibodies were used: anti-CD11b (BioRad MCA711, 1:400), anti-pSTAT3 Y705 (Cell Signaling Technology 4113 ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies diluted in EveryBlot Blocking Buffer (Bio-Rad Laboratories) were then added to the membrane and incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...