Labshake search
Citations for Bio-Rad :
101 - 150 of 2676 citations for Primary Human Aortic Smooth Muscle Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and anti-canine distemper virus nucleoprotein mouse monoclonal primary antibody (Biorad) in selected fox tissues.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The primary antibodies are listed as follows: CD68 (Bio-Rad, MCA341GA), CD206 (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies used were mouse anti-PLP1 (Biorad #MCA839G; 1:250) and goat anti-PDGFRα (R&D Systems #AF1062 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies included rat-anti-CD13 (1:250, Bio-Rad; MCA2183EL), goat anti-CD31 (1:200 ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Biochemistry 2020Quote: ... the membrane was incubated with mouse anti-WIPI2b primary antibody (BioRad, MCA5780GA) used at a dilution of 1:1000 in 3% milk/TBST (0.1% Tween20) ...
-
bioRxiv - Cell Biology 2020Quote: Primary FBs were lysed in 1x Laemmli Buffer (Bio-Rad Laboratories, Inc.) and loaded on 4-15% SDS-PAGE gels (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... blots were incubated with primary antibodies (Monoclonal Mouse anti-β-Actin, BioRad, Cat ...
-
bioRxiv - Cell Biology 2022Quote: The following primary antibodies were used: anti-β-actin (#MCA5775GA, Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2020Quote: ... The sections were then incubated with primary antibodies against CD68 (Bio-Rad) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... Depending on the primary antibody separated proteins were transferred to nitrocellulose (BioRad) or ...
-
bioRxiv - Immunology 2022Quote: ... hFAB Rhodamine anti-GAPDH primary antibody (Bio-Rad, cat. 12004168, 1:10,000).
-
bioRxiv - Immunology 2021Quote: ... Primary MBECs were seeded on coverslips pre-coated with 0.1 % gelatin (BioRad). Fixation and permeabilisation steps were carried out as for DCs ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies were detected using horseradish-peroxidase conjugated anti-rabbit antibodies (BioRad) and detected with Western Lightning ECL reagents.
-
bioRxiv - Neuroscience 2023Quote: ... Following primary antibodies were used: anti-CD68 (rat 1:600, BioRad, MCA1957T), anti-Galactin1 (rabbit 1:200 ...
-
bioRxiv - Systems Biology 2023Quote: ... The following primary antibodies were used: anti-CD11b (BioRad MCA711, 1:400), anti-pSTAT3 Y705 (Cell Signaling Technology 4113 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies were diluted in 5% milk (Bio-Rad, Hercules, CA, USA) in TBST ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies diluted in EveryBlot Blocking Buffer (Bio-Rad Laboratories) were then added to the membrane and incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Microbiology 2019Quote: ... Primary antibodies were detected using HRP- conjugated secondary antibodies (Bio-Rad, 1:5,000) and ECL (ThermoFisher Pierce) ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: CD68 (rat monoclonal FA-11, Bio-Rad), Iba1 (goat polyclonal ...
-
bioRxiv - Bioengineering 2020Quote: ... Samples were incubated with the primary antibodies (1:100 dilution; CD68, Bio-Rad, Cat# MCA1957 ...
-
bioRxiv - Pathology 2022Quote: ... and then stained with primary antibodies against F4/80 (Cl:A3-1, Bio-Rad) and Ly6G or CD3ε (#87048S and #99940 ...
-
bioRxiv - Immunology 2022Quote: ... 100μL per well of the primary antibodies (CD63 (Cat. No. MCA2142, Bio-Rad) and HLA-ABC (Cat ...
-
bioRxiv - Physiology 2024Quote: ... Primary antibodies were diluted in TBS-T containing 5% dry nonfat milk (Biorad). Membranes were incubated overnight at 4 °C with primary antibody ...
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... with goat anti-human IgG F(ab’)2-HRP (STAR126P, Bio-Rad) as the detection antibody.
-
bioRxiv - Biophysics 2020Quote: ... and mouse anti-human CD34 (QBEND 10 clone, Ms IgG1, Bio-Rad). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.
-
bioRxiv - Cancer Biology 2021Quote: ... and resuspended in FACS buffer with Fc-block (Human Seroblock, Bio-Rad). These samples were then re-pelleted and suspended in a cocktail of fluorophore-conjugated primary antibodies (Supp ...
-
bioRxiv - Immunology 2020Quote: ... and incubated with either FITC-conjugated Sheep Anti-Human C3 (BioRad AHP031F) at 1:500 or AF488-conjugated Mouse Anti-C5b-9 (ae11 ...
-
Antiviral roles of interferon regulatory factor (IRF)-1, 3 and 7 against human coronavirus infectionbioRxiv - Microbiology 2022Quote: ... human IFN-γ and IFN-λ 1 were obtained from Bio-Rad, BD Pharmingen and R&D Systems respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... and G-CSF quantification using a human Bio-plex PRO assay (Biorad) following the manufacturer’s instructions and acquired with the Luminex200 instrument (Luminex).
-
bioRxiv - Immunology 2023Quote: ... with human IgA positive and negative controls (Bio-Rad, Cat No. 12014775), Bio-Plex SARS-CoV-2 Wuhan-1 strain RBD and N coupled beads (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... A human RPP30 copy number assay labeled with HEX (Bio-Rad, dHsaCP1000485) was used to measure total allelic copy numbers ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-Rad using HuCAL technology ...