Labshake search
Citations for Bio-Rad :
51 - 100 of 2665 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and growth factors in culture supernatants of control or R1881 treated LNCaP cells was determined using the Bioplex Pro Human Cytokine 17-plex assay system (Bio-Rad) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies used were: GFP (4745-1051, Bio-Rad) and PanCK (Z0622 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following primary antibodies were used: anti-DAZL (BioRad MCA2336 ...
-
bioRxiv - Microbiology 2022Quote: ... primary antibody and goat anti-rabbit HRP conjugate (BioRad) secondary antibody ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and incubation with primary antibodies (collagen IV: Bio-Rad, #134001 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Primary anti-MOMA2 (cat#: MCA519G) was purchased from BioRad. Secondary antibody HRP conjugated-rabbit anti-goat IgG (cat# ...
-
bioRxiv - Neuroscience 2022Quote: Primary antibodies used were as indicated: Vinculin (Bio-Rad Cat# MCA465GA ...
-
bioRxiv - Cell Biology 2023Quote: ... we used primary alpha-tubulin rat antibody (Bio-rad) diluted 1:200 in 1% BSA in PBS for 1.5 hours at room temperature and secondary antibody anti-rat Alexa Fluor 647 (Invitrogen ...
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Cancer Biology 2020Quote: 10 μg of protein samples harvested from xenografted human cells were separated in pre-casted 4-15% gradient SDS gels (Biorad, #456-1084) and transferred to nitrocellulose membranes (Millipore #IPVH00010) ...
-
bioRxiv - Immunology 2020Quote: ... Multiplexed cytokine measurements on macrophage cell culture supernatants were performed using a custom Bio-Plex Express Human Cytokine kit (Bio-Rad 17004073) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Human and murine breast cancer cells were washed with PBS and lysed on ice using 1x Laemmli Sample Buffer (Biorad #161-0737) supplemented with protease (Sigma-Aldrich #P8340 ...
-
bioRxiv - Immunology 2023Quote: ... Pro-inflammatory and pro-fibrotic mediators were measured in 50µl of cell-free tissue culture supernatants using a 37-Plex Bio-Plex Pro™ Human Inflammation Panel 1 (Bio-Rad #171AL001M) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... sections were stained with primary anti-BRDU (BU1/75, BioRad), anti-muc2 antibody ...
-
bioRxiv - Neuroscience 2019Quote: ... The primary antibodies against PLP (1:1000, Bio-Rad, MCA839G), CD68 (1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... rat α-tubulin primary antibody (RID AB_325005, MCA78G, Bio-Rad) was diluted 1:200 in 1X PBS-BSA ...
-
bioRxiv - Cell Biology 2024Quote: ... a rat anti-mouse CD206 primary antibody (Bio-Rad, USA), or a rat anti-mouse F4/80 primary antibody (Abcam ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
bioRxiv - Immunology 2019Quote: ... For detection of primary antibodies anti-rabbit-HRP (170-6515, BioRad), and anti-mouse-HRP (170-6516 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μl primary rat anti-tubulin antibody (Bio-Rad AbD Serotec) at a 1:50 dilution in PBS/1%BSA was added and the slide incubated in a dark wet chamber at room temperature for 2 h ...
-
bioRxiv - Neuroscience 2022Quote: ... the primary antibody used was 1:100 CD68 (rat, Bio-Rad), and the secondary antibody was anti-rat Cy3 (Jackson Immunoresearch ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CldU primary antibody (rat anti-BrdU, Biorad OBT0030S; Lot# 0109) or IdU primary antibody (mouse anti-BrdU ...
-
bioRxiv - Cell Biology 2020Quote: ... The primary antibody binding was processed for ECL detection (Bio-Rad) with appropriate HRP-conjugated secondary antibodies (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-canine distemper virus nucleoprotein mouse monoclonal primary antibody (Biorad) in selected fox tissues.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The primary antibodies are listed as follows: CD68 (Bio-Rad, MCA341GA), CD206 (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies used were mouse anti-PLP1 (Biorad #MCA839G; 1:250) and goat anti-PDGFRα (R&D Systems #AF1062 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies included rat-anti-CD13 (1:250, Bio-Rad; MCA2183EL), goat anti-CD31 (1:200 ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...