Labshake search
Citations for Bio-Rad :
1 - 50 of 1753 citations for Partitioning Defective 6 Homolog Beta PARD6B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg of in vitro-transcribed RNA (2.5 μg of SNX27/LRFN2 RNA and 2.5 μg of the defective helper plasmid) was electroporated into 0.6×107 BHK-21 cells using a Gene Pulser II electroporation system (BioRad) in a gene pulser cuvette (0.2 cm gap) ...
-
bioRxiv - Plant Biology 2023Quote: The closest CORE homologs from ‘Frost nucellar Eureka’ lemon and ‘Washington navel’ orange were amplified using iProof DNA polymerase (Bio-Rad #BR0114). PCR products were cloned into a pEARLY103 backbone (Earley et al ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... and beta mercaptoethanol (0.05 M, BioRad Laboratories Cat#1610710) and loaded into a NuPAGE 4%–12% or 10% Bis-Tris Gel (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... with 10% beta-mercaptoethanol (BME) (Bio-Rad 161-0710) was added to 15µg of total protein.
-
bioRxiv - Microbiology 2023Quote: ... and 0.25ul of beta-mercaptoethanol (Bio-Rad #161-0710) and boiling the reaction at 100C for 5 minutes ...
-
bioRxiv - Genetics 2023Quote: ... A SDS buffer containing 5% beta-mercaptoethanol (Bio-Rad) was added to the samples ...
-
bioRxiv - Cell Biology 2024Quote: ... The labeled antibodies are purified by P-6 Micro Bio-Spin Columns (BioRad).
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Immunology 2022Quote: ... with beta-mercaptoethanol and run using a Mini-PROTEAN Electrophoresis and Transfer system (BioRad). Membranes were incubated with primary antibody overnight at 4°C (ME1 ...
-
bioRxiv - Physiology 2023Quote: ... We normalized the protein bands to beta-tubulin with Image Lab software (Bio-Rad). For citrate synthase activity ...
-
bioRxiv - Immunology 2019Quote: ... Rosa26LSL-tdTomato/+ animals (6-12 weeks) were given 1 μg of FITC-conjugated rat anti-CD169 antibody (BioRad) diluted in a total volume of 20 μl of PBS into the right footpad to label CD169+ subscapular macrophages inside the draining LN ...
-
bioRxiv - Biophysics 2021Quote: ... Micro Bio-Spin 6 Columns (molecular weight cutoff 6 kDa; Bio-Rad) were used at 1,000 × g and 4 °C to exchange purified protein samples to 250 mM ammonium acetate (99.99 % purity ...
-
bioRxiv - Immunology 2022Quote: TGF-beta isoforms were measured with the Bio-Plex Pro TGF-β assays (Bio-Rad) in accordance with manufactures directions ...
-
bioRxiv - Neuroscience 2022Quote: ... input and precipitated samples were prepared in 5x SDS buffer containing beta-mercaptoethanol (Bio-Rad) and boiled for 5 minutes at 90° C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ASM and AIM proteins were dissolved in 2X Laemmli buffer (95% buffer - 5% beta-mercaptoethanol) (BioRad). As observed by Ramos-Silva et al ...
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2019Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house ...
-
bioRxiv - Microbiology 2020Quote: ... Beta- and Gammatorquevirus (See Dataset S7) was performed using the CFX96 Real-Time detection system (Bio-Rad) based upon values obtained with a set of purified amplicons used as standards.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... antigen retrieval was performed in trypsin (pH 7.8) or 10 mM sodium citrate buffer (pH 6) and then incubated with F4/80 antibody (1:50; MCA497, Bio-Rad) or UCP-1 antibody (1:500 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Immunology 2023Quote: ... primary B cells were activated as above and then lysed with 4X Laemmli buffer with beta-mercaptoethanol (BioRad) to a final concentration of 1X ...
-
bioRxiv - Microbiology 2020Quote: Resuspended purified beta-propiolactone treated SARS-CoV-2 virus preps were separated by SDS-PAGE (Bio-Rad TGX Mini) and transferred to 0.2 µM PVDF membrane according to the manufacturer’s protocols (Bio-Rad Tansblot Turbo) ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 2.5% (v/v) beta-mercaptoethanol and ran on a 4-20% TGX gel (BioRad #5671094 and #5671095). Protein was transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Molecular Biology 2020Quote: ... and protein concentrations were equalized prior to boiling in the recommended sample buffers supplemented with 2.5% beta-mercaptoethanol (Bio-Rad). SDS-PAGE electrophoresis was performed using 4-12% gradient bis-tris gels or 16% tricine gels (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lysates were reduced in LDS with beta-mercaptoethanol and then polyacrylamide gel electrophoresis was performed on 4-20% Protean Mini TGX gels (Biorad) and transferred to Immobilon PVDF membranes for 15 minutes using mini TGX settings on the Trans-Blot-Turbo system (Biorad) ...
-
bioRxiv - Physiology 2021Quote: ... and proteins were stripped from beads by incubation in gel loading buffer with beta-mercaptoethanol and loaded to 4-15 % gels (Criterion; BioRad) for SDS-PAGE ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and protein concentrations were equalized prior to boiling in the recommended sample buffers supplemented with 2.5% beta-mercaptoethanol (Bio-Rad). SDS-PAGE electrophoresis was performed using 4–12% gradient bis-tris gels (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... The production of carbapenemase was tested by combination disc test method (EUCAST 2017) and biochemical tests (BioRad-Beta-Carba test) while carbapenem hydrolysis was tested by MALDI-TOF (Papagiannitsis et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked with 6% milk (BioRad 1706404) in Tris buffered saline (TBS ...
-
bioRxiv - Biophysics 2020Quote: ... or Micro Bio-Spin 6 columns (Bio-Rad)) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... The extracts were separated on 6% polyacrylamide (Biorad) gel and transferred onto nitrocellulose membranes in Tris/glycine transfer buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 6 mL gravity flow columns were from Biorad, Germany.
-
bioRxiv - Immunology 2022Quote: ... and the primers for murine IFNAR 1 and beta-Actin in a MyiQ™ Single-Color Real-Time PCR System (BioRad). Products of RT-PCR were separated by electrophoresis on a 2.5% agarose gel in 1x TBE buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with beta-mercaptoethanol and denaturated at 95 °C for 5 min before loading on a 12 % PAA precast gel (#4561044, Bio-Rad). The gel was run at 70 V for 15 min and then 100 V for 1 h ...
-
bioRxiv - Plant Biology 2023Quote: ... and 10 (V/V) % beta-mercaptoethanol for 5 minutes before being loaded into a 4-20% gradient SDS-PAGE gel (Biorad: 4561096) and run according the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Surface Plasmon Resonance (SPR) binding experiments were carried out on a ProteOn XPR36 6×6 channels protein interaction array system (Bio-Rad). Proteins BRD4-BD1 an BRD4-BD2 were diluted to a final concentration of 50μg/ml in HEPES buffer 25 mM pH 7.0 and immobilized to a GLM chip using amine coupling ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Master mixes containing primer pairs against FIBCD1 or B2M (Beta-2-microglobulin, housekeeping gene) were prepared with iTaq Universal SYBR Green Supermix (Bio-Rad #1725122). The mastermixes were dispensed into each well containing cDNA and incubated on ice for 15 minutes to allow the cDNA to dissolve ...
-
bioRxiv - Physiology 2023Quote: ... 0.03% bromophenol blue) containing 9% beta-mercaptoethanol and separated by Mini-Protean TGX gel 4 - 15% (BioRad, stain-free gels #4568084, 4561035) and blotted onto Amersham Hybond-P PVDF membrane ...
-
bioRxiv - Microbiology 2020Quote: ... pH6.9 using a micro biospin 6 column (Bio-Rad). The FOS sample was diluted to ∼500 µM with 0.5 M ammonium acetate ...
-
bioRxiv - Microbiology 2020Quote: ... and Bio-Plex Manager software (v.6, Bio-Rad). The data were expressed as median fluorescence intensity (MFI ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein samples were mixed with LDS sample loading buffer at 4X concentration followed by addition of beta-mercaptoethanol (5%) (Bio-Rad, Hercules, CA). The resultant mixture was denatured at 95°C for 9 min ...