Labshake search
Citations for Bio-Rad :
151 - 200 of 667 citations for Neuroligin 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... membranes were de-stained and blocked for 5 minutes with EveryBlot Blocking Buffer (BIO-RAD; 12010020). Membranes were incubated with spastin primary antibody (Sp 3G11/1 ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... membranes were blocked at room temperature for 1 h with 1X casein blocking solution (Bio-Rad) (#1610782) ...
-
bioRxiv - Cell Biology 2023Quote: ... P-ATG16L1-S278 antibody was diluted at 1:4000 in EveryBlot blocking buffer (Bio-Rad, 12010020) and incubated overnight ...
-
bioRxiv - Developmental Biology 2023Quote: Sections were incubated in blocking serum (0.2% animal serum and 0.02% Bio-Rad TritonX in PBS) for 60 minutes at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 5 minutes with EveryBlot Blocking Buffer (12010020 Bio-Rad, Hercules, California, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... The membranes were incubated with 5% Blocking-grade blocker non-fat milk (Cat no. 1706404, Bio-Rad) plus 0.5% Bovine Serum Albumin (BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then blocked for 1 hours in 1X TBS 1% Casein Blocker (blocking buffer) (Bio-Rad #1610782).
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were incubated shaking for 1 hour at RT with 4% blocking solution (5% milk powder (BioRad) in TBS-T) ...
-
bioRxiv - Neuroscience 2024Quote: ... then incubated in blocking buffer containing horseradish peroxidase-conjugated secondary antibodies at 1:10,000 dilution (Bio-Rad #172-1011 or 172-1019 ...
-
bioRxiv - Immunology 2022Quote: Excess Eα peptide was removed with Bio-spin 30 kDa size exclusion columns (Bio-Rad Laboratories) equilibrated with PBS according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoblot detection of 6xHIS and 2A peptide tags were determined through anti-Histidine tag (AD1.1.10, Biorad) and anti-2A peptide (3H4 ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the membrane blots were blocked in 5% blocking buffer (5% non-fat dry milk, Bio-Rad, in TBST) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... After blocking for 45 minutes at room temperature with 10% non-fat milk (Blotting-Grade Blocker, Bio-Rad) in TBS containing 0.01% Tween 20 (TBS-T) ...
-
bioRxiv - Microbiology 2020Quote: ... The membranes were incubated overnight at 4°C in blocking solution 5% (w/v) Blotting-Grade Blocker (BioRad) in PBS-Tween buffer (1× PBS ...
-
bioRxiv - Immunology 2021Quote: ... diluted 1:15000 in blocking buffer) followed by a goat anti-rabbit-HRP conjugate (170-6515, Bio-Rad, Hercules ...
-
bioRxiv - Genetics 2019Quote: ... and the PVDF membrane was blocked in 5% non-fat dry milk-based blocking-grade blocker (Bio-Rad) for 1 hr at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... membranes were housed in clear blotting boxes and blocked in 5% blocking buffer in TBS-T (BIORAD 1706404) for 40 min at +25°C ...
-
bioRxiv - Cell Biology 2024Quote: ... The slides were covered in a blocking solution made up of in Tris-buffered saline (#1706435; Bio-Rad) with 0.1% (vol/vol ...
-
bioRxiv - Genomics 2024Quote: ... TBST (EZ BioResearch #S-1012, diluted to 1X in deionized water) and EveryBlot Blocking Buffer (Bio-Rad #12010020) were used for washing and blocking ...
-
bioRxiv - Plant Biology 2020Quote: ... Peptide concentration was determined by a modified Lowry procedure using the DC Protein Assay (BioRad; Munich, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: Electrophoresis was used to separate peptides in a 16.5% Mini-PROTEAN® Tris-Tricine Gel (Bio-Rad) with tris-tricine (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... 20 mL blocking buffer supplemented with 5 μL of horseradish peroxidase (HRP) conjugated rabbit anti-mouse secondary antibody (BioRad) was added and incubated for 2 hours at room temperature with agitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... the Netherlands) and blocked for 1 hour at room temperature using Odyssey blocking buffer (LI-COR biosciences, Bio-Rad) in a 1:1 dilution with tris-buffered saline (TBS ...
-
bioRxiv - Cell Biology 2023Quote: ... endogenous peroxidase activity was blocked in 3.5% (v/v) hydrogen peroxide and blocking with 10% donkey serum (Bio-Rad) was performed ...
-
bioRxiv - Cell Biology 2023Quote: ... endogenous peroxidase activity was blocked in 3.5% (v/v) hydrogen peroxide and blocking with 10% donkey serum (Bio-Rad) was performed ...
-
bioRxiv - Immunology 2023Quote: ... Plates were washed (previously described) and 100 μL of diluted mouse serum (PBST wash buffer, 0.1% Biorad Blocking Agent) was added in duplicate and incubated for one hour at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The transferred membrane was briefly washed with TBST (0.1% Tween-20 in TBS) and blocked with Blocking Buffer (5% Blotting-Grade Blocker [1706404, BioRad] or 5% BSA [A9647-50G ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Supernatants were transferred to new tubes and peptide concentrations were quantified using the DC Protein Assay (Bio-Rad). Peptides were labeled using 10-plex TMT reagents as described above and 4 μg of proteins were used for each TMT channel ...
-
bioRxiv - Cancer Biology 2022Quote: ... Supernatants were transferred to new tubes and peptide concentrations were quantified using the DC Protein Assay (Bio-Rad). 50 μg of each sample were set aside for TMT labeling ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Biochemistry 2021Quote: ... The membrane was let dry and thereafter blocked on a shaker for 10 min in 15 ml blocking buffer (1% casein in TBS, BioRad). The blocking solution was discarded ...
-
bioRxiv - Neuroscience 2022Quote: ... The blots were then treated with HRP-conjugated goat anti-moue secondary antibody (1:10000) diluted in blocking solution for 1 h and developed with enhanced chemiluminescent (ECL) substrate (Cat#1705060, Biorad).
-
bioRxiv - Genomics 2020Quote: ... Membranes were washed using tris-based saline buffer solutions with 0.1% tween-20 (TBST) and blocking solutions were prepared using 5% w/v western-blot grade dry milk powder (Biorad). Membranes were blocked with blocking buffer for 1 hour and washed between incubations for 5-10 mins (3x) ...
-
bioRxiv - Immunology 2022Quote: ... Primary antibodies (for further specification see key resource table, table 1) were diluted in blocking solution (F4/80 [Bio-Rad] ...