Labshake search
Citations for Bio-Rad :
151 - 200 of 7508 citations for Myeloperoxidase MPO Human ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... Levels of inflammatory cytokines were quantified using Bio-Plex Pro Human Inflammation Panel 1 37-plex (#171AL001M) magnetic bead-based assay (Bio-Rad Laboratories) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Pro-inflammatory and pro-fibrotic mediators were measured in 50µl of cell-free tissue culture supernatants using a 37-Plex Bio-Plex Pro™ Human Inflammation Panel 1 (Bio-Rad #171AL001M) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations were determined using Bradford Assay Kit 1 (Bio-Rad) and 30µg of protein were loaded onto 8% SDS-Page Gels (Thermo Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Levels of the following 27 cytokines were analyzed using a BioPlex Pro™ Human Cytokine 27-plex Assay kit (#M500KCAF0Y, Bio-Rad, Hercules, CA, USA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplicates of each sample were run per plate (Hard-shell PCR Plates 96 well, thin wall; Bio-Rad), which were sealed with Microseal ‘B’ Seals (BioRad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplicates of each sample were run per plate (Hard-shell PCR Plates 96 well, thin wall; Bio-Rad), which were sealed with Microseal ‘B’ Seals (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification reactions of each DNA sample were performed in PCR plates (hard-shell PCR plate, #HSP9645; Bio-Rad), in a volume of 25 μl containing 12.5 μl PCR buffer (HotstarTaq mastermix ...
-
bioRxiv - Cell Biology 2019Quote: ... Bio-Dot SF Microfiltration Apparatus plates (BioRad) were used to transfer the protein samples onto the nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2021Quote: ... in 96 well PCR plates (Bio-Rad) on a CFX96 Touch Real Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... in 96-well reaction plates (Bio-Rad). For pS6- and Sst-TRAP experiments ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were imaged using a ChemiDoc (Biorad).
-
bioRxiv - Immunology 2023Quote: ... plates were placed in a thermocycler (BioRAD), where it is heated to 65 °C for 2min and cooled to 10 °C for 5min ...
-
bioRxiv - Biochemistry 2023Quote: ... In a qPCR plate (Bio-Rad MLL9601), 1 µL of cDNA was dispensed ...
-
bioRxiv - Plant Biology 2023Quote: In a 96-well qPCR plate (Biorad), 5 µL of 10 µM total protein of sfGFP1-10 Ni-NTA eluate in storage buffer (10mM Tris ...
-
bioRxiv - Immunology 2023Quote: ... Plates were placed in a thermocycler (BioRAD) with the following program ...
-
bioRxiv - Neuroscience 2023Quote: ... sealed with PX1 PCR plate sealer (BioRad) and cycled in a T100 Thermal Cycler (BioRad ...
-
bioRxiv - Plant Biology 2023Quote: ... with hard-shell-96 well plates (BIORAD). Each reaction was carried out with 4 μL master mix (Titan HotTaq EvaGreen ...
-
bioRxiv - Immunology 2024Quote: ... with 96-well plates (Bio-Rad Laboratories), Microseal ‘B’ plate sealers (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: IgE receptor cross-linking (IgECL) on HSMCs was accomplished through sensitization with 1 μg/mL chimeric human IgE anti-NP antibody (MCA333S, BIO-RAD, Hercules, CA) for 24 hours ...
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Immunology 2020Quote: ... followed by measuring the absorbance of individual wells at 450 nm using an ELISA reader (Bio-rad mod.550). Serum samples from unmanipualted mice were used for negative controls.
-
bioRxiv - Microbiology 2020Quote: ... 10.5 μl template DNA and 1 μl respective primer pairs (200 nM final concentration, supplementary table 1) were mixed and distributed into a 96-well qPCR plate (Bio-Rad). The plate was incubated 10 min at room temperature to digest the target DNA before droplets were generated in an Automated Droplet Generator (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 µl HeLa lysate was preincubated with 1 µl of accessory protein for 10 min at room temperature in PCR plates (HSP9601, Bio-Rad). Reaction was started by adding 2 µl reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... 550 µl of the assembled community was added into each well of the “Community Plates Day 1” with an epMotion 96 (Bio-Rad) semi-automated electronic 96 channel pipette ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR plate was subsequently heat-sealed with pierceable foil using a PX1™ PCR plate sealer (Bio-Rad) and then amplified in a LifeEco thermal cycler (Bioer ...
-
bioRxiv - Biophysics 2021Quote: ... The PCR plate was subsequently heat-sealed with pierceable foil using a PX1 PCR plate sealer (Bio-Rad, USA) and then amplified in a Veriti thermal cycler (Applied Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... Droplets were transferred to a 96-well PCR plate and heat-sealed using PX1 PCR Plate Sealer (Bio-Rad). PCR amplification was performed with the following conditions ...
-
bioRxiv - Microbiology 2023Quote: ... the OD600 of the 96-well plate was recorded by a plate reader (iMarkTM microplate absorbance reader, Bio-Rad). The minimum inhibitory concentration (MIC ...
-
bioRxiv - Bioengineering 2022Quote: Total RNA was purified with 1) Aurum Total Mini Kit (Bio-Rad) using the spin column method with DNase 1 (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad; Cat#1864022) and same set of primers and probe used for SIV plasma viral load quantification ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of RNA was reverse transcribed (iScript cDNA Synthesis Kit (BioRad)) and the cDNA was purified with QiaQuick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2022Quote: ... total RNA (1 μg) was reverse transcribed using the SuperScript kit (BioRad), and the Real-time PCR was performed in three technical replicates using the Applied Biosystems StepOnePlus Real-Time PCR system and Fast SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Genomics 2023Quote: ... then embedded in 1% low-melt agarose blocks (BioRad Plug Kit #1703591) to preserve DNA integrity ...
-
bioRxiv - Biophysics 2023Quote: ... Single-stranded cDNA was synthesized from 1 µg of total RNA as template using a commercially available kit (iScript cDNA Synthesis Kit, Biorad). RT-qPCR analysis of nascent mRNA abundance was performed in duplicate using iQ SYBR Green Supermix (Biorad #1708880 ...
-
bioRxiv - Molecular Biology 2023Quote: ... One aliquot was used to synthesize single-stranded cDNA starting from 1 µg of total RNA using a commercially available kit (iScript cDNA Synthesis Kit, Biorad).
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...