Labshake search
Citations for Bio-Rad :
1 - 50 of 7990 citations for Mouse Calcitonin Gene Related Peptide Type 1 Receptor CALCRL ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal anti-MF20 (DSHB, Cat# MF 20, dilution 1:20) rabbit polyclonal anti-Calcitonin Receptor (Bio-RAD, Cat# AHP635, dilution 1:2000), chick anti-GFP (abcam ...
-
bioRxiv - Plant Biology 2020Quote: Forward and reverse new PCR primers for the 12 Zn transport-related genes and the two reference genes suitable for SYBR® Green II RT-qPCR assays (Biorad, USA) were designed (Table 2) ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed for the expression of the exosome production-related genes listed in Appendix Table 1 by RT-PCR on a CFX Connect Real-Time System (Bio-Rad Laboratories).
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti Human Protein Gene Product 9.5 (PGP9.5) (1:500, MCA4750GA mouse monoclonal, Biorad) for 36 h at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... specific for the various human chemokine receptor genes and IQ™ SYBR green reagent (# 170882, BIO-RAD) on CFX96 real-time PCR detection system (BIO-RAD) ...
-
bioRxiv - Immunology 2023Quote: ... to block Fc receptors and stained with biotinylated anti-mouse F4/80 (clone: Cl:A3-1, cat:MCA497B, BIO-RAD), PerCP-Cy5.5-conjugated streptavidin (551419 ...
-
bioRxiv - Cell Biology 2020Quote: ... Transformation of wild-type cells was performed using electroporation using a Gene Pulser (BioRad) and a total of 35,000 clones (35 pools of ~1000 clones/pool ...
-
bioRxiv - Cell Biology 2019Quote: ... estrogen receptor (Santa Cruz sc-542, 1:20; BioRad MCA1799T, 1:25), Ltf (Bioss bs-5810 ...
-
bioRxiv - Microbiology 2019Quote: ... Serum was collected at day 49 and anti-M1 titers were measured by ELISA as previously described72 with a goat anti-mouse HRP-conjugated secondary antibody at 1:5000 (BioRad). Immunized and control mice were infected subcutaneously into the flank with 2×107 cfu of the AP1 (n=17 ...
-
bioRxiv - Genetics 2023Quote: The expression levels of non-ribosomal peptide synthetase genes were assessed using a real-time amplifier CFX96 (Bio-Rad, USA) and a commercial “PCR-mix SYBR Green I kit” (Syntol ...
-
bioRxiv - Immunology 2020Quote: Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
bioRxiv - Biochemistry 2022Quote: Ceramic hydroxyapatite (CHTTM, type 1, Bio-Rad, Hercules, CA), a crystalline mineral [(Ca5(PO4)3OH)2] with multimodal functionalities ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Glucagon-like peptide 1 (GLP-1) and Adiponectin were measured using quantitative Bio-Plex Pro™ Mouse Diabetes 8-Plex immunoassay (#171F7001M; Bio-Rad Laboratories, Hercules, CA, USA) and Bio-Plex Pro Mouse Diabetes Adiponectin assay #171F7002M (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2021Quote: Inoculation of UCBSV full-length clones (wild type and derivatives) was carried out by biolistic with the Helios Gene Gun System (Bio-Rad) by following a previously described protocol (Salvador et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes targeting the male-specific mouse Zfy1 gene (BioRad Custom Assay, Hercules, CA) were used to detect engraftment as opposite sex donors/recipients were used ...
-
bioRxiv - Microbiology 2022Quote: ... and molecular weights were measured related to the proteins ladder (Precision PlusProtein All Blue Standards #1610373, Bio-Rad) using the Image Lab analysis software (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gene expression was quantified with the SsoFast EvaGreen supermix kit (BioRad, #1725204) using a thermocycler (StepOne™ #4376374 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Isolated cell types were further lysed in 1 ml Purezol (Biorad) to proceed with RNA extraction.
-
bioRxiv - Cancer Biology 2021Quote: ... XP2OS cells were transfected with 200 ng of plasmid containing the XPA VUS of interest or wild-type XPA as well as the FM-HCR reporter plasmids using the Gene Pulser MXCell Plate Electroporation System (Bio-Rad Laboratories #165-2670). Plate electroporation was performed at 260 V ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti- Collagen-Type IV (Collagen-IV) (Bio-RAD, 2150-1470, 1:400) and anti-VEGF164 (R&D Systems ...
-
bioRxiv - Biochemistry 2021Quote: ... and passed over a Mini CHT hydroxyapatite Type 1 column (Bio-rad). The unbound fraction was collected and concentrated using a Vivaspin 6 (3 kDa MWCO ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Collagen-Type IV (Collagen-IV) (Bio-RAD, 2150-1470, 1:400) and anti-VEGF164 (R&D Systems ...
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Plant Biology 2020Quote: ... Endpoint analysis and allelic discrimination related to SNP calls were accomplished using the CFX96 Touch™software (BioRad, CA, USA). The DNA of the restorer line Primepi was used as a reference control for Rf3 (Geyer et al ...
-
bioRxiv - Immunology 2020Quote: Multiplex ELISA (Biorad; CA, USA) was performed to detect cytokines in BALF ...
-
bioRxiv - Cell Biology 2019Quote: ... Immunostaining for the vitronectin receptor (VNR) was with anti-CD51/61 (clone 23C6, 1:400; Bio-Rad, Oxford, UK) and for cathepsin K with a rabbit polyclonal antibody (3368-100 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The plasmid curing vector was introduced into the wild-type strains by electroporation (1.8 kV, 25 µFar, 200 Ω) using Gene Pulser Xcell™ electroporation system (Bio-Rad Laboratories Inc., California, USA) as described before15 ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-CD63 and anti-CD81 detection antibodies (supplied in the MACSPlex kit, 5 µl each) or anti-decoy receptor antibodies (AlexaFluor647-labelled anti-human TNFR1, Bio-Rad, cat #MCA1340A647 ...
-
bioRxiv - Microbiology 2023Quote: ... following either random priming or gene specific primers by iScript cDNA synthesis kit (BioRad). 20 μL of cDNA reaction is diluted 5 times before the quantitative PCR reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μL 20x target (FAM) and wild-type (HEX) primers/probe (Bio-Rad) and 9 uL of ddH2O ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-V5-Tag:DyLight-550 mouse (1:400, Bio-Rad), chicken anti-GFP (1:400 ...
-
bioRxiv - Neuroscience 2020Quote: ... and a rabbit anti-vasoactive intestinal peptide (1:500, catalog: 9535-0204, Bio-Rad). The secondary antibodies used in a study were as follows ...
-
bioRxiv - Microbiology 2020Quote: ... 2.5kV cm-1 in a Gene Pulser apparatus (BIO-RAD, Hercules, CA, USA). Cell recovery was performed in ice-cold super optimal broth with catabolite repression media (SOC ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Proteins and peptides bearing C-terminal 6xHis tags were detected with mouse anti-6xHis antibody clone AD1.1.10 (BioRad; Cat # MCA1396GA) while detection of glycosylated CRM197-FtO-PS was with anti-F ...
-
bioRxiv - Physiology 2024Quote: ... Fc-receptors were then blocked for 15 minutes using FcBlock (BioRad – BUF041A). Cells were pelleted by centrifugation (300 x g,5 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Fc-receptors were then blocked for 15 minutes using FcBlock (BioRad – BUF041A). Cells were pelleted by centrifugation (300 x g ...
-
bioRxiv - Molecular Biology 2023Quote: To prepare the tubing for gene gun delivery one tubing and 25 mg of Au particles with 1 µm Ø was used from Helios Gene Gun Optimization Kit (Bio-Rad, Hercules, CA, USA). 10 µg of the synthesized RNA transcript was used four labeling Au particles ...
-
bioRxiv - Cell Biology 2022Quote: ... Gene expression analysis was performed by using SYBR Green 1 (Bio-Rad, USA, 1725121) and LightCycler480 Thermocycler (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... coli strain S17-1 using a Gene Pulser Xcell™ (Bio-Rad, CA, USA) with the conditions of 2.5kV ...
-
bioRxiv - Bioengineering 2020Quote: ... mouse CD68 (Biorad, 1:200, MCA341GA), mouse CD45R (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... or anti-mouse (1:5000, BioRad). Stained membrains were developed with SuperSignal West Pico chemo luminescent substrate ...
-
bioRxiv - Microbiology 2022Quote: ... mouse anti-LAMP-1 (MCA2315GA; BioRad), rabbit anti-VPS11 (PA5-21854 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mouse anti-V5 (Biorad, 1:2000); Anti-SCD6 and anti-DHH1 (From Susanne Kramer ...
-
bioRxiv - Genomics 2021Quote: ... mouse CD163 (1:100, BIORAD, MCA1853), rabbit Laminin (1:100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... using gene-specific primers for stem-loop qPCR or the iScript cDNA Synthesis Kit (BioRad, 1708890). cDNA was analyzed using SYBR Green Master Mix (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... Viral gene segments were visualised by silver staining using the Silver Stain Plus Kit (Bio-Rad) according to manufacturer’s instructions and imaged using a Samsung Xpress C480FW scanner.
-
bioRxiv - Immunology 2023Quote: ... Then gene expression was determined by SYBR green real-time PCR using SYBRTM Premix kit (BioRad) and was expressed using the 2 -ΔΔCt method ...
-
bioRxiv - Plant Biology 2021Quote: Gene expression analysis of selected genes was performed using Quantitative real-time iCycler (BioRad) and QuantiTect SYBR® Green PCR Kits (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... We included two housekeeping genes determined by Reference Gene H384 panel by Bio-Rad: rps18 and ppia ...