Labshake search
Citations for Bio-Rad :
101 - 150 of 333 citations for M CSF Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Proteins were transferred onto a 0.45-m-pore-size polyvinylidene difluoride (PVDF) membrane (Bio-Rad, #1620177) and processed for immunoblotting ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed in monomer solution (1 x PBS, 2 M NaCl, 2.5% acrylamide (Bio-Rad), 0.15% Methylenbisacrylamide (Santa Cruz) ...
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were probed for 1 hour at room temperature with 1:500 anti-XLF(New England Peptides, details in Methods under Immunodepletion) or 1:1000 anti-His (Bio-Rad MCA1396A) in PBST with 2.5% BSA ...
-
bioRxiv - Pathology 2019Quote: ... Affi-gel 10 affinity resins were covalently cross-linked to his-tagged GT198 protein as antigen for affinity purification of anti-GT198 according to the manufacturer’s protocol (Bio-Rad, Hercules, CA). FFPE tumor sections or tumor microarrays were deparaffinized and dehydrated through xylene and ethanol series ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 M NaCl) for 30 minutes and the DNA was transferred to a Zetaprobe membrane (Bio-Rad) in 20X SSC ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction products were resolved on 15% denaturing PAGE gel with 7 M Urea (Bio-Rad #3450091), and was exposed to a phosphor screen (Amersham ...
-
bioRxiv - Plant Biology 2019Quote: ... the immunoprecipitated chromatin was reverse crosslinked and eluted from the beads with 10% (m/w) Chelex (Biorad) and digested with proteinase K at 50°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each column then received 200 µL of ProteOn 1 M Ethanolamine hydrochloride pH 8.0 (BioRad, Cat. # 1762450) and was incubated for 4 hours to quench any remaining active site on the resin ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was then incubated with HRP-conjugated anti-His monoclonal antibody (1:5000) and detected with supersignalfemto substrate (Thermoscientific, USA) using ChemiDoc imaging system (Bio-Rad laboratories, USA).
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Microbiology 2024Quote: ... and HopAM1 and C-terminal Flag-tagged IpaH4 were generated by PCR amplification using primers containing Flag sequences and flanking SacII / PacI off pIB/V5-His templates using iProof DNA polymerase (Bio-Rad; Table S4) and cloned into the pDGOpIE2 vector ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Biochemistry 2020Quote: ... Immunocaptured EVs on Dynabeads M-280 Tosylactivated were lysed by 4x Laemmli Sample Buffer (Bio-Rad Laboratories, Inc.) under nonreducing condition (without DTT ...
-
bioRxiv - Biochemistry 2023Quote: ... or double stained with polyclonal anti-M antiserum (1:1000) and monoclonal anti-F (1:500, BIO-RAD) antibodies ...
-
bioRxiv - Immunology 2023Quote: ... unreacted ITC-DTPA was removed by dialysis against 0.25 M ammonium acetate (NH4Ac) pH 5.4–5.5 (metal free) supplemented with 2 g/L Chelex (Bio-Rad) using 20,000 molecular weight cut-off dialysis cassettes (Slide-a-Lyzer ...
-
bioRxiv - Biochemistry 2022Quote: ... solutions containing purified CytbX were buffer-exchanged into 0.2 M ammonium acetate (pH 8.0) containing 2x CMC of Lauryldimethylamine oxide (LDAO) using Biospin 6 columns (Biorad). 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2023Quote: ... ATOM sensors were desalted into experimental buffer (20 mM Tris, pH 8.0, 0.15 M NaCl, 0.005 % TWEEN-20) using DG10 columns (Bio-Rad) and experiments were begun immediately ...
-
bioRxiv - Microbiology 2023Quote: ... separated on 6% acrylamide 8 M urea gels and transferred to Zeta Probe GT membranes (Bio-Rad laboratories) by electroblotting ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.14 M NaCl (PBS) followed by removal of the reductant using a Micro Bio-Spin 6 column (Bio-Rad). Columns were washed and pre-equilibrated with 20 mM phosphate buffer pH 7.4 containing 0.1 mM diethylenetriamine-penta-acetic acid (DTPA ...
-
bioRxiv - Biochemistry 2020Quote: ... and the supernatant was mixed with urea (0.5 M final concentration) before batch binding overnight at room temperature (RT) to nickel-charged IMAC resin (Profinity, BioRad) that had been previously equilibrated with the DARET Lysis Buffer ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... was cut into 1.7 M lengths to match the length of the tubing preparation station (Bio-Rad, Hercules, CA). Using 10ml ddH2O ...
-
bioRxiv - Microbiology 2022Quote: All proteins were buffer exchanged into 0.2 M ammonium acetate using Bio-Spin P-6 Size Exclu-sion Spin Columns (BioRad) as previously described47 ...
-
bioRxiv - Biochemistry 2021Quote: ... Transcriptionally active Q0.3 fraction (0.32–0.4 M) were pooled and applied directly to hydroxyapatite (HAP) type II ceramic resin (Bio-Rad), washed first at 0.38 M ...
-
bioRxiv - Pathology 2021Quote: ... Slides were kept in 0.1 M TRIS buffer (pH 7.5) until the in-situ hybridization frame seals (BIO-RAD) were glued to the slide around the sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PEI pellet was dissolved in 0.4 M ammonium sulfate buffer and applied onto a column packed with Macro-Prep High Q resin (Biorad). The eluted peak was then precipitated with 4 M ammonium sulfate and the re-dissolved pellet applied onto an 8WG16 antibody column ...
-
bioRxiv - Microbiology 2021Quote: ... SOB motility plates (containing 10-4 M IPTG and 2.4 g/L MgSO4) at 37°C and pictures were taken using a Gel Doc (Biorad) imager at the beginning and the end of the linear swimming motility period (from 5 to 8 hours) ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein transfer was performed in transfer buffer (0.192 M glycine, 25 mM Tris base, 20 % EtOH in ddH2O) in a TransBlot Turbo System (BioRad). After the transfer all proteins were visualized by Ponceau staining ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were diluted to 4 M urea with water for Bradford Assay quantification (Bio-Rad Laboratories, Inc, Hercules, CA) and trypsin digestion ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The reactions were run at 125 V for 2.5 hours on a denaturing (6 M urea) 20% (w/v) polyacrylamide gel in 50 mM NaOAc pH 5.2 running buffer (using the Biorad Mini- PROTEAN tetra gel ...
-
bioRxiv - Neuroscience 2024Quote: ... proteins were transferred by wet-blotting with Tris-Glycine buffer (250 mM Tris base, 1.92 M Glycine and 10% methanol) onto a nitrocellulose membrane (BioRad). After completion of the transfer ...
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... with goat anti-human IgG F(ab’)2-HRP (STAR126P, Bio-Rad) as the detection antibody.
-
bioRxiv - Biophysics 2020Quote: ... and mouse anti-human CD34 (QBEND 10 clone, Ms IgG1, Bio-Rad). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.