Labshake search
Citations for Bio-Rad :
51 - 100 of 3844 citations for L Leucine 3 4 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 30-50 μg of total protein was boiled at 99°C for 5 minutes with the addition of Laemmli Sample Buffer (1610747, Bio-Rad) containing 1% 2-Mercaptoethanol in a total volume of 60-80 μl ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were then treated according to the instruction of the beads and the protein complexes were then eluted by incubating at 99°C for 5 minutes with Laemmli Sample Buffer (1610747, Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-mouse IgG (H+L) or goat anti-rabbit IgG (H+L) (Bio-Rad) were used as secondary antibodies ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... for DpnII digested DNA or primers 3 and 4 (table S3) for NlaIII digested DNA on a thermal cycler (Bio-Rad C1000 Touch) with the block settings shown in table 1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... for DpnII digested DNA or primers 3 and 4 (table S2) for NlaIII digested DNA on a thermal cycler (Bio-Rad C1000 Touch). PCR amplified samples were purified using the NucleoSpin Gel and PCR cleanup kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2023Quote: ... heated in water bath for 5 minutes at 99°C and analysed by SDS-PAGE using Any-kD Mini-PROTEAN TGX Stain-Free gels (Bio-Rad, California, USA) in a 2-minute run for sample clean-up purposes ...
-
bioRxiv - Microbiology 2019Quote: ... “L”represents the Western C (BioRad) protein ladder ...
-
bioRxiv - Microbiology 2022Quote: ... the indicated ESA supernatant was boiled in SDS-PAGE sample buffer and 3 μg of each sample was run with a 4-15% TGX gradient gel (Bio-Rad cat. no. 4561086), then transferred to a nitrocellulose membrane ...
-
bioRxiv - Microbiology 2021Quote: ... intracellular cathepsin L activity was detected using the Magic Red Cathepsin L Assay Kit (Biorad cat# ICT941). Briefly ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... goat anti-mouse IgG(H+L)- or goat anti-rabbit IgG(H+L)-HRP conjugated (Bio-Rad, 1721019), followed by chemiluminescent detection with Clarity Western ECL Substrates (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... or SuperSignal West Femto (Thermo Fisher Scientific 34096)] on the ChemiDox XRSL+L(Bio-Rad).
-
bioRxiv - Cancer Biology 2021Quote: ... 4-15% Tris-HCI 4 SDS-PAGE gels (Bio-Rad), separated at 120V ...
-
bioRxiv - Biochemistry 2024Quote: ... 4-20% (BioRad), or 6% (Thermofisher ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... Goat anti-mouse IgG (H/L): HRP (Biorad)
-
bioRxiv - Plant Biology 2023Quote: ... anti-rabbit IgG (H + L) secondary antibody and goat peroxidase-conjugated anti-mouse IgG (H + L) secondary antibody were purchased from Bio-Rad.
-
A tyrosine kinase protein interaction map reveals targetable EGFR network oncogenesis in lung cancerbioRxiv - Cancer Biology 2020Quote: ... 4 μl of the eluate was analyzed by 4-20% SDS PAGE (Biorad) and silver staining ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... 0.1 μg/mL anti-rhesus IgG (H+L) (BioRad), and irradiated 3T3msCD40L feeder cells ...
-
bioRxiv - Immunology 2023Quote: ... 0.1 μg/ mL anti-rhesus IgG (H + L) (BioRad), and irradiated 3T3msCD40L feeder cells ...
-
bioRxiv - Biochemistry 2021Quote: ... A goat anti-rabbit IgG (H+L) and goat anti-mouse IgG (H+L) antibody with HRP conjugate (1706515 and 1706516, respectively, Bio-Rad, Hercules, CA) was used as a secondary detection antibody ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4–20% gel (Bio-Rad) using SDS-PAGE ...
-
bioRxiv - Cell Biology 2019Quote: ... 4-20% gradient gels (BioRad) and transferred to 0.2 μm nitrocellulose membranes (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.8 × 4 cm (Bio-Rad). The column was washed with 10 column volumes (c.v. ...
-
bioRxiv - Cell Biology 2020Quote: ... 4-20% TGX gels (BioRad) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Microbiology 2023Quote: ... 4% low-melt agarose (BioRad) was prepared in 100 mM sodium cacodylate buffer and kept liquid at 70 °C until needed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-rabbit IgG (H + L)-HRP (1:5000, BioRad,1706516) and anti-mouse IgG (H + L)-HRP (1:5000 ...
-
bioRxiv - Immunology 2021Quote: ... goat anti-rabbit IgG (H+L)-HRP conjugate (both Biorad) or Veriblot IP detection reagent (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: ... goat anti-mouse IgG (H+L)-HRP conjugate (Biorad 1706516), AffiniPure goat anti-rabbit IgG (H+L)-HRP conjugate (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2021Quote: ... and Goat Anti-Mouse IgG (H+L)∼HRP Conjugate (BioRad). Membranes were developed with SuperSignal® West Pico Luminol/Enhancer Solution (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... sheep anti-mouse IgG (H/L):HRP (AAC10P, Bio-Rad), anti-FLAG-Tag (M2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4% CHAPS and deStreak (BIORAD, Australia). Two equilibration steps were carried out in SDS equilibration buffer consisting of SDS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Lastly 4 μl TEMED (Bio-Rad) and 6 μl freshly prepared Ammonium persulfate (Bio-Rad ...