Labshake search
Citations for Bio-Rad :
1 - 50 of 66 citations for Ketoconazole EP Impurity D since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Differentiation Protocol-Dependent Variability in hiPSC-Derived Endothelial Progenitor FunctionalitybioRxiv - Bioengineering 2024Quote: ... CD34+-hiPSC-EPs were isolated using a fluorescence-activated cell sorting instrument (S3e; Bio-Rad). Gating and population analysis were performed with Bio-Rad software native to the S3e cell sorter.
-
bioRxiv - Bioengineering 2022Quote: ... and CD34+ hiPSC-EPs were isolated using a fluorescence-activated cell sorting (FACS) instrument (S3e; Bio-Rad). Gating and population analysis were performed with Bio-Rad software native to the S3e cell sorter.
-
bioRxiv - Microbiology 2023Quote: ... using 2 mm electroporation cuvettes (Cell Projects, EP-102) and electroporation program Ec2 (V = 2.5 kV) with MicroPulser Electroporator (Biorad). Plasmid sequences were confirmed by sanger sequencing.
-
bioRxiv - Microbiology 2023Quote: ... Each 100 μl aliquot was transformed with 0.1 pmol of EZ-Tn5
Tnp Transposome using 2 mm electroporation cuvettes (Cell Projects, EP-102) and electroporation program Ec2 (V = 2.5 kV) with MicroPulser Electroporator (Biorad). Each reaction was allowed to recover in 500 μl SOC (2% tryptone ... -
bioRxiv - Microbiology 2020Quote: Quantity One 1-D Analysis Software (Bio-Rad) was used to estimate band intensities of each sample ...
-
bioRxiv - Immunology 2021Quote: ... and DiaClon Anti-D (Bio-Rad, Basel, Switzerland) were used ...
-
bioRxiv - Genetics 2023Quote: ... and Quantity One 1-D analysis software (Bio-Rad). Band density was normalized to the background and statistically analyzed by Student’s t-test in Prism 9 software.
-
bioRxiv - Genetics 2023Quote: ... and analyzed with D-10 Hemoglobin Analyzer (Bio-Rad).
-
bioRxiv - Cancer Biology 2024Quote: ... Dharmacon, Cambridge, UK) or siRNAs targeting MYC (D-003282-14 & D-003282-35, Dharmacon) using siLentFect transfection reagent (1703362, Biorad, Hercules, CA, USA) (see Table S4 for siRNA sequences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed with Quantity One 1-D software (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... and samples were analyzed with D-10 Hemoglobin Analyzer (Bio-Rad). HbA2 and HbE cannot be distinguished by this method.
-
β-catenin signaling via astrocyte-encoded TCF7L2 regulates neuronal excitability and social behaviorbioRxiv - Neuroscience 2020Quote: ... Densitometric analyses were performed using Quantity One 1-D software (BioRad).
-
bioRxiv - Immunology 2020Quote: ... Hemoglobin typing was performed using a D-10 instrument (Bio-Rad). Blood for ABO typing was collected in EDTA containing microtainers ...
-
bioRxiv - Genetics 2024Quote: ... Phosphorylated bands were analysed using Quantity One 1-D (Bio-Rad) as previously described (Ustaoglu et al ...
-
bioRxiv - Biochemistry 2024Quote: ... and HPLC analysis was performed with D-10 Hemoglobin Analyzer (Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... and cleaned with the ReadyPrep 2-D cleanup kit (1632130, Bio-Rad). The pellet obtained was dissolved in 10 μL of 20 mM Tris-HCl (pH 7.2 ...
-
bioRxiv - Physiology 2024Quote: ... using the Quantity One 1-D Analysis software (Bio-Rad, Hercules, CA). All protein data has been normalized to loading control and total protein expression by quantifying the total protein in the entire lane ...
-
bioRxiv - Neuroscience 2020Quote: ... Blots densitometric analyses were performed using Quantity One 1-D software (Bio-Rad) and compared with that made by MCID.
-
bioRxiv - Plant Biology 2024Quote: Samples from PSB-D suspension culture cells in 1× Laemmli loading buffer (BioRad) with reducing agent (1× NuPage [Invitrogen] or 100 mM DTT ...
-
bioRxiv - Molecular Biology 2022Quote: ... FhNEJ-Teg extract was purified using the ReadyPrep 2-D Cleanup Kit (BioRad) and the protein pellets resuspended in rehydration buffer [7 M urea ...
-
bioRxiv - Biophysics 2024Quote: ... made fresh and deionized with MG AG 501-X8 (D) resin from Biorad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Band densitometry analysis was performed using Quantity One 1-D Analysis Software (Bio-Rad). To normalize across different gels and to encompass all 3 ages and genotypes ...
-
bioRxiv - Plant Biology 2022Quote: ... Extracted proteins were further purified using the BioRad ReadyPrep 2-D Cleanup Kit (BioRad), approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad ...
-
bioRxiv - Molecular Biology 2020Quote: ... The eluted fraction was precipitated with Ready Prep 2-D cleanup kit (Bio-Rad, USA). The precipitate was dissolved in O’Farrell lysis buffer and analyzed with 2D polyacrylamide gel electrophoresis ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were washed twice using D-PBS and permeabilised using 0.25% Triton X (Bio-Rad) in D-PBS for 20 min ...
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Microbiology 2021Quote: ... Electrophoresis was performed in the D-Code™ Universal Mutation Detection System (BioRad, Hercules, CA, USA) at 90 V for 8.5 h ...
-
bioRxiv - Neuroscience 2022Quote: ... A GS-800 calibrated densitometer with Quantity One 1-D Analysis Software 4.6 (Bio-Rad Laboratories) was used for quantitative analysis of protein levels ...
-
bioRxiv - Microbiology 2020Quote: ... Data were quantified using a Personal Molecular Imager with Quantity One 1-D analysis software (Bio-Rad) and analyzed with GraphPad Prism 4 software.
-
bioRxiv - Biochemistry 2024Quote: ... and the band intensities were quantified and analyzed using Quantity One 1-D software (Bio-Rad Laboratories).
-
bioRxiv - Molecular Biology 2024Quote: ... The levels of proteins bound to chromatin were quantified using Quantity One 1-D Analysis Software (BioRad) and normalized with their corresponding Histone H2B values ...
-
bioRxiv - Molecular Biology 2023Quote: ... and individual band densities were measured and compared using Quantity One 1-D analysis software (Biorad, USA). The resulting values were normalized separately for each set of time points.
-
bioRxiv - Cancer Biology 2023Quote: ... Blots were visualized using the VersaDoc Imaging System with Quantity One 1-D Analysis software (Bio-Rad).
-
bioRxiv - Molecular Biology 2020Quote: ... IPG strips were run upon SDS PAGE (12.5% acrylamide) using the Protean® II 2-D Cell (BioRad). Gels were then Coomassie blue stained (Phastgel Blue R ...
-
bioRxiv - Cell Biology 2023Quote: ... Three hundred micrograms of protein was precipitated using a ReadyPrep 2-D Cleanup Kit (Bio-Rad Laboratories, USA) at −20 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... Screens were analyzed using a Molecular Imager FX and the Quantity One 1-D Analysis Software (Bio-Rad).
-
bioRxiv - Pathology 2022Quote: ... The expression levels of target proteins were quantified with Quantity One 1-D Analysis Software (Bio-Rad, Hercules, CA) and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Cell Biology 2021Quote: Samples were run on 4-20% TGX Precast Gels (BioRad) (except Figure 5C and D, in which samples were run on 7.5% TGX Precast gels (BioRad)) ...
-
bioRxiv - Biophysics 2021Quote: ... Urea solutions were purified by passage of the stock solution through an AG501-X8(D) ion-exchange resin (Biorad) before use74.
-
bioRxiv - Plant Biology 2024Quote: ... The gels were visualised using a UV trans-illuminator Gel Doc 2000 and Quantity One 1-D analysis v4.6.5 software (Bio-Rad).
-
bioRxiv - Synthetic Biology 2024Quote: ... Signal intensities were quantified using the Quantity One 1-D Analysis Software (Version 4.6.6) (Bio-Rad, Hercules, CA, USA). sRNA signal intensities were normalized to the corresponding 5S rRNA signals.
-
bioRxiv - Plant Biology 2024Quote: ... RNA was subsequently reverse-transcribed to cDNA using the iScript cDNA Synthesis Kit (Bio-Rad, INST-653 Ver D). For the qPCR analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... Visualisation and quantification were carried out using a Personal Molecular Imager with Quantity One 1-D analysis software (Bio-Rad) and data were analyzed with GraphPad Prism 4 software.
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... 40S and 80S fractions were quantified using Quantity One 1-D Analysis Software v.4.1.2 (Bio-Rad Laboratories, Hercules, CA). Pno1 was quantified using ImageJ Software v1.52 (100 ...
-
bioRxiv - Biochemistry 2021Quote: ... Melting temperature was determined from the region of maximal slope as visualized by the first derivative of fluorescence with respect to temperature (minimal-d(RFU)/dT) per default behavior of Bio-Rad CFX manager software (BioRad).
-
bioRxiv - Biochemistry 2023Quote: ... 2mM DTT and 0.02% n-dodecyl-β-D-maltopyranoside [DDM]) buffer after transferring into Econo columns (Biorad, Cat. no. 7372512). Thrombin at concentration 1unit µL-1 was added to the resin slurry at 1:1 (dry resin:cleavage buffer ...
-
bioRxiv - Immunology 2024Quote: ... and RANTES/CCL5 (R&D Biotechne) according to the manufacturer’s protocol and analyzed using the Bio-Plex 200 platform (Bio-rad). Analyte concentrations were calculated using a standard curve (5 PL regression ...