Labshake search
Citations for Bio-Rad :
51 - 100 of 1480 citations for IL 3 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Systems Biology 2021Quote: ... Quantitative analyses of blotted hCDKL5 and His-Neuropinilin were carried out with Image Lab software (BioRad) and the volumetric yield was derived considering the final biomass concentration (OD600 ...
-
bioRxiv - Immunology 2023Quote: ... Colorimetric (standards) and chemiluminescent detection (His-tagged proteins) were performed using the ChemiDoc Imager (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... The plate was washed 3 times prior to adding 50 μl of 1:1000 diluted Goat anti-Mouse IgG H+L-HRP antibody (Bio-Rad, Cat# 172-1011) to the plate and incubated for 1 h at RT ...
-
bioRxiv - Microbiology 2021Quote: ... and data was analysed using the QuantaSoft Software (Bio-Rad, IL USA). Genomic DNA of SN15 (- ...
-
bioRxiv - Immunology 2023Quote: ... IL-17 and MIP-1α by multiplex immunoassay (Bio-Rad, Hercules, CA).
-
bioRxiv - Biochemistry 2022Quote: ... and the protein was passed through Hi-Q anion exchange column (Bio-Rad Laboratories, Hercules, CA, USA) to remove minor nucleic acid contamination ...
-
bioRxiv - Plant Biology 2021Quote: Purified His and GST fusion proteins or GST alone (500 ng) were blotted onto nitrocellulose membrane (BioRad). The nitrocellulose membrane was rinsed with TBS-T buffer (10 mM Tris-HCl at pH 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... Eluents were collected and incubated with 50μL of packed Ni-NTA resin (Bio-Rad His-Pur 88222) at room temperature with nutating for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cultures were induced with IPTG and His-MBP-ORC2 was purified on Ni-NTA beads (BioRad). Purified protein was injected into rabbits for serum generation and collection (Cocalico Biologicals) ...
-
bioRxiv - Biophysics 2022Quote: ... His-tagged σs was added to phosphorylated/unphosphorylated RssB in Micro Bio-Spin Chromatography columns (Bio-Rad) before removing 6μL of the input for SDS-PAGE analysis and adding 40μL of prepared HisPur Ni-NTA resin (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... and IL-18 were measured on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... IL-1β gene expression was quantified by PrimePCR FAM Probe assay (Bio-rad) using SsoAdvanced Universal Probes Supermix (Bio-rad ...
-
bioRxiv - Microbiology 2019Quote: ... and IL-1 β were measured with Bio-Plex® custom Assay (BIORAD) using a Bio-plex 200 ...
-
bioRxiv - Microbiology 2020Quote: ... was used to purify the C-terminal 6X-His EfgA with 1 mL Ni-NTA columns (Bio-Rad). Columns were equilibrated with 10 mL of Buffer A at 1 mL/min prior to loading lysates ...
-
bioRxiv - Biochemistry 2022Quote: ... and eluted from the C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad) by the acidic acetonitrile gradient.
-
bioRxiv - Microbiology 2023Quote: ... His-tagged proteins in the cleared lysate were purified using Profinity™ IMAC Nickel Charged Resin (Bio-Rad) and eluted in 50 mM sodium phosphate buffer with 300 mM NaCl pH 8 and 300 mM imidazole (Fischer Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted using PureZOL reagent (Bio-Rad Laboratories, Des Plaines, IL, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The plate was subsequently loaded into the QX200 Plate Reader (Bio-Rad, IL USA) and data was analysed using the QuantaSoft Software (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... run on a CFX96 Real-Time System (Bio-Rad Laboratories, Des Plaines, IL, USA). Relative mRNA expression of each gene of interest (GOI ...
-
bioRxiv - Cell Biology 2023Quote: ... Bio-Plex Pro Human Inflammation Panel 1 IL-28A / IFN-λ2 (Bio-rad, 171BL022M), Bio-Plex Pro Human Inflammation Panel 1 ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... His-tagged recombinant protein was purified using Ni-NTA purification with the help of Ni-charged resins (Bio-Rad). Purified protein was further used for kinase assay ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-V5-Tag:DyLight-550 mouse (1:400, Bio-Rad), chicken anti-GFP (1:400 ...
-
bioRxiv - Genetics 2021Quote: ... RNA was reverse-transcribed using an iScript cDNA synthesis kit (Bio-Rad, Des Plaines, IL). Assay of RNA via quantitative PCR [qPCR] was performed with iTaq universal SYBR green supermix (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... qPCR was conducted using iQ SYBR green supermix (Biorad, cat# 1708880, Des Plaines, IL, USA) and Bio-Rad CFX96 Fast Real-Time PCR Systems ...
-
bioRxiv - Biochemistry 2022Quote: ... The refolded mature FAM237A was eluted from the C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad) by the acidic acetonitrile gradient.
-
bioRxiv - Microbiology 2023Quote: ... The was filtered through a 0.45 μm filter and His-MSI-2 was purified with HisTrapTM FF column (Cytiva) using the Econo Gradient Pump (BIORAD) according to the manufacturer’s protocol and overnight dialysis ...
-
bioRxiv - Microbiology 2023Quote: ... Ni-NTA agarose with the bound His-SUMO-SigN was loaded on a Poly-Prep® Chromatography Column (Bio-Rad), washed with P2 buffer and subsequently with the P2 buffer with the 30 mM imidazole ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentrations were determined with the Bradford quantification assay (Bio-Rad Laboratories, Des Plaines, IL, USA), using BSA (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were determined using a Micro Bradford Protein Assay Kit (Bio-Rad, Rockford, IL, USA). Samples with equal quantities of protein (50 μg ...
-
bioRxiv - Biochemistry 2021Quote: ... The recovery of tag-less MlaC was quantified using the ratio standard curve method (41) while that of His-tagged nanodisc-embedded complexes were quantified using the Lowry assay (DC Protein Assay, Bio-Rad). For retrograde assay ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Membranes were then washed 3 times with 1X TBST for 10 minutes each before being transferred to a solution containing enhanced chemiluminescence (ECL) substrate to allow visualization of His-tagged sfGFP (Bio-Rad). The blotted proteins were visualized in a ChemiDoc Imaging System (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: Purified recombinant His-tagged proteins were diluted to 0.5µg/ml in either Laemmli sample buffer alone (Bio-Rad, Hercules, CA, USA) or containing 50 mM dithiothreitol (DTT ...
-
bioRxiv - Biochemistry 2023Quote: ... The 6× His-tag blots were washed with TMST and TSM and developed with the Clarity Western ECL kit (Bio-Rad) and imaged in a Gel-Doc system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-CD8 (Biorad:MCA1226GA) 10 µg ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-Mouse HRP (BioRad) was used as a secondary detection antibody and immunoblots were developed with Forte HRP substrate (Millipore ...
-
bioRxiv - Immunology 2019Quote: ... and mouse serum (BioRad). Blocking and subsequent surface staining was performed using PBS containing 2 mM EDTA ...
-
bioRxiv - Immunology 2020Quote: ... and mouse serum (BioRad). Blocking and subsequent surface staining was performed using PBS containing 2 mM EDTA ...
-
bioRxiv - Immunology 2023Quote: ... Mouse (Biorad, 10025637, qMmuCED0044924).
-
bioRxiv - Biochemistry 2023Quote: ... Secondary α-mouse (BioRad) and α-rabbit (BioRad ...
-
bioRxiv - Cell Biology 2023Quote: ... WIPI2 (BioRad, MCA5780GA, mouse), AMBRA1 (Santa Cruz Biotechnologies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...