Labshake search
Citations for Bio-Rad :
251 - 300 of 2961 citations for IL 1 beta Rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and data was analysed using the QuantaSoft Software (Bio-Rad, IL USA). Genomic DNA of SN15 (- ...
-
bioRxiv - Immunology 2023Quote: ... IL-17 and MIP-1α by multiplex immunoassay (Bio-Rad, Hercules, CA).
-
bioRxiv - Developmental Biology 2021Quote: ... Immunohistochemistry was performed using rat anti-BrdU (MCA2060 GA, Bio-Rad), rabbit anti-Sp7/Osx (sc-22536-r ...
-
bioRxiv - Bioengineering 2020Quote: ... A FITC-conjugated rat anti-mouse CD204 monoclonal antibody (Bio-Rad) was prepared 1:200 in DMEM or CDMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μl primary rat anti-tubulin antibody (Bio-Rad AbD Serotec) at a 1:50 dilution in PBS/1%BSA was added and the slide incubated in a dark wet chamber at room temperature for 2 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CldU primary antibody (rat anti-BrdU, Biorad OBT0030S; Lot# 0109) or IdU primary antibody (mouse anti-BrdU ...
-
bioRxiv - Microbiology 2020Quote: ... The following antibodies were used: mouse anti-rat CD43 antibody (BioRad), rabbit polyclonal Surfactant C (Proteintech) ...
-
bioRxiv - Physiology 2023Quote: ... and rat anti-mouse cd68 (5 µg/mL, MCA1957, Bio-Rad) diluted in PTxwH buffer for 4 days ...
-
bioRxiv - Immunology 2023Quote: ... The expression of immune system markers were mostly studied with inmunohistochemistry using the following antibodies: mouse anti rat CD68 (dilution 1:300 BIORAD, ref. MCA 341R) for monocytes/macrophages ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with beta-mercaptoethanol and denaturated at 95 °C for 5 min before loading on a 12 % PAA precast gel (#4561044, Bio-Rad). The gel was run at 70 V for 15 min and then 100 V for 1 h ...
-
bioRxiv - Plant Biology 2023Quote: ... and 10 (V/V) % beta-mercaptoethanol for 5 minutes before being loaded into a 4-20% gradient SDS-PAGE gel (Biorad: 4561096) and run according the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were then transferred onto a nitrocellulose membrane (GE-Healthcare, Chicago, IL, USA) for 1 hour at 15V using the Trans-Blot semi-dry transfer system (Bio-Rad Laboratories, Hercules, CA, USA). After transfer ...
-
bioRxiv - Immunology 2021Quote: ... and IL-18 were measured on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... IL-1β gene expression was quantified by PrimePCR FAM Probe assay (Bio-rad) using SsoAdvanced Universal Probes Supermix (Bio-rad ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Master mixes containing primer pairs against FIBCD1 or B2M (Beta-2-microglobulin, housekeeping gene) were prepared with iTaq Universal SYBR Green Supermix (Bio-Rad #1725122). The mastermixes were dispensed into each well containing cDNA and incubated on ice for 15 minutes to allow the cDNA to dissolve ...
-
bioRxiv - Physiology 2023Quote: ... 0.03% bromophenol blue) containing 9% beta-mercaptoethanol and separated by Mini-Protean TGX gel 4 - 15% (BioRad, stain-free gels #4568084, 4561035) and blotted onto Amersham Hybond-P PVDF membrane ...
-
bioRxiv - Immunology 2021Quote: ... slides were incubated in PBS with rat anti-CD8 (Bio-Rad, YTC182.20) plus either rabbit polyclonal anti-SARS-CoV-2 Spike/RBD (Sino ...
-
bioRxiv - Pathology 2022Quote: ... and rat monoclonal anti-F4/80 antibody (Bio-Rad Laboratories, Inc., MCA497GA). Vectastain ABC kit (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Tub1 (rat monoclonal anti-tubulin alpha, (Bio-Rad Cat# MCA77G, RRID:AB_325003)) (1:10000 dilution each in PBS-T) ...
-
bioRxiv - Neuroscience 2021Quote: ... the rat anti-mouse anti-IFN-γ antibody (Bio-Rad, Oxford, UK) and tyrphostin A47 (a tyrosine protein kinase [TPK] specific blocker ...
-
bioRxiv - Neuroscience 2023Quote: ... rat monoclonal anti CD68 (clone FA-11, 1.4 ug/ml, Bio-Rad), rabbit polyclonal anti Iba-1 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein samples were mixed with LDS sample loading buffer at 4X concentration followed by addition of beta-mercaptoethanol (5%) (Bio-Rad, Hercules, CA). The resultant mixture was denatured at 95°C for 9 min ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted using PureZOL reagent (Bio-Rad Laboratories, Des Plaines, IL, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The plate was subsequently loaded into the QX200 Plate Reader (Bio-Rad, IL USA) and data was analysed using the QuantaSoft Software (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... run on a CFX96 Real-Time System (Bio-Rad Laboratories, Des Plaines, IL, USA). Relative mRNA expression of each gene of interest (GOI ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: CD68 (rat monoclonal FA-11, Bio-Rad), Iba1 (goat polyclonal ...
-
bioRxiv - Cancer Biology 2021Quote: ... and rabbit F(ab’)2 anti-rat IgG conjugated to FITC (STAR17B, BioRad).
-
bioRxiv - Physiology 2023Quote: ... and goat anti-rat PE (50x stock concentration not reported, STAR73, Bio-Rad) diluted in PTxwH buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... Target proteins were detected by chemiluminescence with Clarity™ (Beta-actin and GFP) and Clarity Max™ (SP) Western ECL Substrate kit (Bio-Rad®) on the Odyssey FC system (LI-COR) ...
-
bioRxiv - Genetics 2021Quote: ... RNA was reverse-transcribed using an iScript cDNA synthesis kit (Bio-Rad, Des Plaines, IL). Assay of RNA via quantitative PCR [qPCR] was performed with iTaq universal SYBR green supermix (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... qPCR was conducted using iQ SYBR green supermix (Biorad, cat# 1708880, Des Plaines, IL, USA) and Bio-Rad CFX96 Fast Real-Time PCR Systems ...
-
bioRxiv - Cancer Biology 2019Quote: ... FITC-conjugated rat anti-mouse CD68 mAb (clone FA-11, Bio-Rad, Oxford, UK), PE-conjugated rat anti-mouse CD206 mAb (clone MR6F3 ...
-
bioRxiv - Neuroscience 2020Quote: ... The rat monoclonal anti-tubulin antibody (AbD Serotec, Bio-Rad, Cat# MCA77G, RRID: AB_325003) recognizes the alpha subunit of tubulin ...
-
bioRxiv - Physiology 2021Quote: ... adipose tissues were stained with rat anti-F4/80 primary antibody (Bio-Rad, #MCA497B) and goat anti-rat HRP polymer (Cell IDX ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular proteins were detected using the rat monoclonal antibody anti-tubulin (MCA77G, Bio-Rad) diluted 1:3000 in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... oocytes were exposed to an anti-α-tubulin antibody (rat monoclonal MCA78G, Bio-Rad) overnight at 4°C and Alexa-Fluor-633-labelled goat anti-rat antibody (A-21094 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentrations were determined with the Bradford quantification assay (Bio-Rad Laboratories, Des Plaines, IL, USA), using BSA (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were determined using a Micro Bradford Protein Assay Kit (Bio-Rad, Rockford, IL, USA). Samples with equal quantities of protein (50 μg ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CD8 (2 µg/rat dissolved in saline solution, clone OX-8, Bio-Rad #MCA48G) or anti-rat TCRαβ antibody (2 µg/rat dissolved in saline solution ...
-
bioRxiv - Cell Biology 2021Quote: ... The following primary antibodies were used: anti–α-tubulin (MCA77G YL1/2, rat monoclonal; Bio-Rad), anti-GAPDH (mouse ...
-
bioRxiv - Cell Biology 2019Quote: Sections of mice peritoneum were stained with primary rat anti-mouse CD68 antibody (MCA1957B, Bio-Rad), rabbit anti-mouse CD38 antibody (bs-0979R ...
-
bioRxiv - Genetics 2019Quote: ... α-tubulin is monoclonal antibody of rat that can recognize alpha subunit (AbD Serotec/BioRad, MCA77G). The second antibodies for staining were Alexa-fluor 488 (Goat ...
-
bioRxiv - Bioengineering 2023Quote: ... Gene analysis of TREM2 (PrimePCR™ SYBR® Green Assay: TREM2 for Rat; BioRad, CA, USA) was performed following the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... and stained with rat anti-mouse CD68 primary antibody (clone FA-11; Bio-Rad, Hercules, CA) followed by biotinylated rabbit anti-rat IgG secondary antibody (Vector Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... a 96-well plate was loaded into the QX200 Auto DG to generate droplets (Bio-Rad, IL USA) in each well ...
-
bioRxiv - Microbiology 2020Quote: ... vascular endothelial growth factor (VEGF) and IL-18 were measured on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... Germany) and lysosomes with rat monoclonal anti-Cd68 (clone FA-11, #MCA1957, Bio-Rad, Hercules, CA, USA). In the second set ...
-
bioRxiv - Neuroscience 2022Quote: ... was used for quantitative real time PCR with commercially available rat Magel2 and Gapdh primers (Bio-Rad, USA ...
-
bioRxiv - Neuroscience 2024Quote: ... For analysis the Bio-Flex Pro™ Rat Cytokines Assay (Bio-Rad, 24-plex panel #171-K1001M) was used on a Bio-Plex® MAGPRIX™ multiplex reader and analysed with Bio-Plex Analysis software (Bio-Rad).