Labshake search
Citations for Bio-Rad :
51 - 100 of 3032 citations for IL 1 beta Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... IL-6 and IL-17 with housekeeping gene β-actin mRNA by qPCR using the iQ™ SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA). Forward and reverse primers and PCR conditions for RT-PCR are listed in Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad), anti-IL11 antibody (X203 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCID0017132) and ACTB - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0036269). The cycles to threshold was measured for each well ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0044963) INSR - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell were labelled with rabbit anti-IL-8 antibody (Biorad Biosciences), mouse anti-IL-1β antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stained with rabbit anti-IL-8 antibody (Biorad Biosciences) and mouse anti-IL-1β antibody (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Bevacizumab (HCA182) and CD126/IL-6R (AHP2449) were obtained from Biorad.
-
bioRxiv - Cancer Biology 2023Quote: ... iQ SYBR green supermix (Biorad, cat# 1708880, Des Plaines, IL, USA) and Bio-Rad CFX96 Fast Real-Time PCR Systems were used to perform qPCR.100ng of cDNA was used per RT-PCR reaction ...
-
bioRxiv - Genetics 2021Quote: ... 1 mM dithiothreitol and 0.5% Tween 20] for 24 hours and its concentration was quantified by Bradford assay (Bio-Rad, Des Plaines, IL).
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... the light chain by the anti-human kappa light chain antibody (1:2,500; Biorad, cat.no. STAR 127) and GAPDH by the anti-GAPDH monoclonal antibody (1:10,000 ...
-
bioRxiv - Immunology 2023Quote: ... or sensitized with 1 mg/mL chimeric human IgE anti-NP antibody (MCA333S, BIO-RAD, Hercules, CA), or in combination for 24 hours ...
-
bioRxiv - Immunology 2024Quote: ... 1:1200 diluted mouse anti-human HLA-E monoclonal primary antibody (clone MEM-E/02, Bio-Rad) and as secondary antibody goat anti-mouse polyclonal antibody conjugated with horse radish peroxidase (HRP ...
-
bioRxiv - Cancer Biology 2024Quote: ... diluted 1:4 and analyzed using Bio-Plex ProTM Human Chemokine Panel 40-plex Assay (Bio-rad). Acquisitions and analyses were performed on a Bio-Plex 200 system with Manager 6.1 Software (Bio-rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and protein concentrations were equalized prior to boiling in the recommended sample buffers supplemented with 2.5% beta-mercaptoethanol (Bio-Rad). SDS-PAGE electrophoresis was performed using 4-12% gradient bis-tris gels or 16% tricine gels (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lysates were reduced in LDS with beta-mercaptoethanol and then polyacrylamide gel electrophoresis was performed on 4-20% Protean Mini TGX gels (Biorad) and transferred to Immobilon PVDF membranes for 15 minutes using mini TGX settings on the Trans-Blot-Turbo system (Biorad) ...
-
bioRxiv - Physiology 2021Quote: ... and proteins were stripped from beads by incubation in gel loading buffer with beta-mercaptoethanol and loaded to 4-15 % gels (Criterion; BioRad) for SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... The production of carbapenemase was tested by combination disc test method (EUCAST 2017) and biochemical tests (BioRad-Beta-Carba test) while carbapenem hydrolysis was tested by MALDI-TOF (Papagiannitsis et al. ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and protein concentrations were equalized prior to boiling in the recommended sample buffers supplemented with 2.5% beta-mercaptoethanol (Bio-Rad). SDS-PAGE electrophoresis was performed using 4–12% gradient bis-tris gels (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... and data was analysed using the QuantaSoft Software (Bio-Rad, IL USA). Genomic DNA of SN15 (- ...
-
bioRxiv - Immunology 2023Quote: ... IL-17 and MIP-1α by multiplex immunoassay (Bio-Rad, Hercules, CA).
-
bioRxiv - Neuroscience 2023Quote: ... and Bio-Plex Pro Human Inflammation Panel 1 (37-plex) (Cat. No. 171AL001M) from Bio-Rad (Hercules, CA).
-
bioRxiv - Immunology 2021Quote: ... rat anti-human CD8 (Bio-Rad), rat anti-human Granzyme B (eBioscience) ...
-
bioRxiv - Genetics 2023Quote: ... Human (Bio-Rad, 10031243, ID: dHsaCP1000002). Reference assay for 3.1 kb deletion and 3.1 kb inversion assays ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-human CX3CR1 (Bio-Rad, AHP566). Mouse TNFα ELISA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human CX3CR1 (Biorad, AHP1589), mouse anti-human CD68 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with beta-mercaptoethanol and denaturated at 95 °C for 5 min before loading on a 12 % PAA precast gel (#4561044, Bio-Rad). The gel was run at 70 V for 15 min and then 100 V for 1 h ...
-
bioRxiv - Plant Biology 2023Quote: ... and 10 (V/V) % beta-mercaptoethanol for 5 minutes before being loaded into a 4-20% gradient SDS-PAGE gel (Biorad: 4561096) and run according the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were then transferred onto a nitrocellulose membrane (GE-Healthcare, Chicago, IL, USA) for 1 hour at 15V using the Trans-Blot semi-dry transfer system (Bio-Rad Laboratories, Hercules, CA, USA). After transfer ...
-
bioRxiv - Immunology 2021Quote: ... and IL-18 were measured on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... IL-1β gene expression was quantified by PrimePCR FAM Probe assay (Bio-rad) using SsoAdvanced Universal Probes Supermix (Bio-rad ...
-
bioRxiv - Neuroscience 2021Quote: ... The isolated placental CD34+ single cell suspension was incubated with human CD34- phycoerythrin (PE) (Bio-Rad; dilution 1:25), human CD45-FITC (BioLegend ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Master mixes containing primer pairs against FIBCD1 or B2M (Beta-2-microglobulin, housekeeping gene) were prepared with iTaq Universal SYBR Green Supermix (Bio-Rad #1725122). The mastermixes were dispensed into each well containing cDNA and incubated on ice for 15 minutes to allow the cDNA to dissolve ...
-
bioRxiv - Physiology 2023Quote: ... 0.03% bromophenol blue) containing 9% beta-mercaptoethanol and separated by Mini-Protean TGX gel 4 - 15% (BioRad, stain-free gels #4568084, 4561035) and blotted onto Amersham Hybond-P PVDF membrane ...
-
bioRxiv - Microbiology 2020Quote: ... monoclonal rat anti-human CD3 (Bio-Rad), rat anti-mouse B220/CD45R (clone RA3-6B2 ...
-
bioRxiv - Immunology 2023Quote: ... Blocked membranes were incubated with HuCAL anti-bovine Mincle CRD antibodies (2.5 µg mL-1) before incubation with secondary goat-anti-human IgG F(ab’)2: HRP (STAR126P, Bio-Rad) antibody ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein samples were mixed with LDS sample loading buffer at 4X concentration followed by addition of beta-mercaptoethanol (5%) (Bio-Rad, Hercules, CA). The resultant mixture was denatured at 95°C for 9 min ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted using PureZOL reagent (Bio-Rad Laboratories, Des Plaines, IL, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The plate was subsequently loaded into the QX200 Plate Reader (Bio-Rad, IL USA) and data was analysed using the QuantaSoft Software (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... run on a CFX96 Real-Time System (Bio-Rad Laboratories, Des Plaines, IL, USA). Relative mRNA expression of each gene of interest (GOI ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...