Labshake search
Citations for Bio-Rad :
51 - 100 of 10000+ citations for Human Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Protein quantification was done using DC protein assay kit (Bio-Rad) according to the manufacturer’s instructions with bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein concentrations were estimated calorimetrically by DC protein assay kit (BioRad). For SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... Purified proteins were quantified by Bradford protein assay kit (Bio-Rad) and validated by SDS-PAGE followed by staining with Coomassie brilliant blue ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatants containing the protein extracts were transferred into fresh 1.5 ml tubes and protein concentration was measured by Bio-Rad Protein Assay Kit using BSA as protein standard (5000002; Bio-Rad). From each sample ...
-
bioRxiv - Cell Biology 2023Quote: ... and protein concentration was estimated by DC protein assay kit (BioRad). For SDS-PAGE ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein concentration was measured using DC Protein Assay Kit (Bio-Rad) and an equal amount of protein was loaded in 8% gel ...
-
bioRxiv - Neuroscience 2023Quote: ... we measured protein concentration (DC™ Protein Assay Kit II, Biorad), and samples were used in subsequent experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentration was determined using a Bradford Protein Assay kit (Biorad). Proteins were separated by SDS-PAGE and transferred to polyvinyl difluoride (PVDF ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein concentrations were measured using the DC protein assay kit (BioRad), and 1-20 µg of protein was loaded onto 4-12% NuPage BisTris gels (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were measured using the DC protein assay kit (BioRad), and 20 ug of protein was loaded onto 4-12% NuPage BisTris gels (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein content was measured using the Lowry protein assay kit (DC Protein Assay; Bio-Rad). Homogenates were sonicated and centrifuged for 15 min at 5000 g ...
-
bioRxiv - Immunology 2023Quote: ... The samples and a protein ladder (a 1:1 mix of All Blue Prestained Protein Standards: Unstained Protein Standards; Precision Plus Protein™, Bio-Rad) were loaded to 4-15% mini-PROTEAN™ TGX Stain-Free™ Protein Gels (Bio-Rad) ...
-
bioRxiv - Plant Biology 2020Quote: ... Endpoint analysis and allelic discrimination related to SNP calls were accomplished using the CFX96 Touch™software (BioRad, CA, USA). The DNA of the restorer line Primepi was used as a reference control for Rf3 (Geyer et al ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: Multiplex ELISA (Biorad; CA, USA) was performed to detect cytokines in BALF ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting pellets were resuspended in homogenization buffer and centrifuged again at 9000 g for 10 min at 4°C and protein concentration was measured using the Quick Start Bradford Protein Assay Kit 1 (Bio-Rad 5000201). Mitochondrial respiration was measured in Mitochondrial Assay Solution (MAS ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... and protein concentration determined with the Bradford-based Protein Assay kit (Bio-Rad Protein Assay, #5000006). The immunoprecipitation of FLAG-Myc was performed by incubating 2 mg of cell lysate with 40 µl of Anti-FLAG M2 affinity gel (Sigma-Aldrich #A2220 ...
-
bioRxiv - Plant Biology 2020Quote: ... Total protein concentration was determined with Bradford protein assay kit (Bio-Rad). An equal amount of protein was loaded onto 12% SDS-PAGE gel for western blot ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein concentrations were measured using a DC Protein Assay kit (Bio-Rad) with BSA protein standards and AccuSkan GO spectrophotometer (Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mitochondrial protein concentration was determined using the Dc-protein determination kit (BioRad).
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations were measured with a DC Protein Assay kit (Bio-Rad) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... and protein concentration was estimated using the DC protein assay kit (Biorad). Protein G agarose (Pierce ...
-
bioRxiv - Cell Biology 2021Quote: ... protein concentration was determined using the DC protein assay kit (Bio-Rad), according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... Protein concentration was quantified using DC™ Protein Assay Kit (Bio-Rad). Human tissue samples were obtained using the INSTA-Blot Human Tissues pre-run western blot (Novus Biologicals) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein concentration was determined using a Bradford Protein Assay Kit (Bio-Rad). Proteins were separated by SDS-PAGE and transferred to polyvinyl difluoride membranes (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined using the DC Protein Assay Kit (Bio-Rad) and a SpectraMax M2e Microplate Reader (Molecular Devices) ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein concentration were quantified using RC DC Protein Assay kit (Bio-Rad). Protein lysates were diluted into 1 μg/μl and kept at −80 °C ...
-
bioRxiv - Genomics 2019Quote: ... Protein amounts were quantified using the DC Protein Assay kit (Bio-Rad). Equal amounts were loaded onto a gel and transferred to a nitrocellulose membrane ...
-
bioRxiv - Microbiology 2019Quote: ... and their protein concentrations were measured using Protein Assay kit (BIO-RAD). We subjected the lysates (2 mg of protein per sample ...
-
bioRxiv - Cell Biology 2021Quote: ... The protein concentration was measured using Bradford Protein Assay kits (Bio-Rad), and 30 μg of each protein was electrophoresed using 10% SDS-PAGE ...
-
bioRxiv - Immunology 2019Quote: ... Protein concentrations were determined using the DCA Protein Assay kit (Bio-Rad). The samples were separated by SDS-PAGE ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined with the bicinchoninic acid (BCA) protein kit (BioRAD).
-
bioRxiv - Microbiology 2021Quote: ... protein concentrations were measured using the DC Protein Assay Kit (Bio-Rad) with BSA (bovine serum albumin ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentration was determined using the DC Protein Assay kit (BioRad #5000111). For both MST2 and βTrCP immunoprecipitation ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentration was determined using the DC Protein Assay kit (BioRad, #5000111). Protein lysate was resuspended at a 0.5 μg/μL concentration in Laemmli sample buffer (0.1% 2-Mercaptoethanol ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein concentrations were measured using a DC Protein Assay kit (Bio-Rad) with BSA protein standards and AccuSkan GO spectrophotometer (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration was determined with Bradford assay (Bio-Rad protein assay kit). An equal amount of proteins was denatured in SDS–PAGE sample buffer ...
-
bioRxiv - Microbiology 2021Quote: ... the protein concentrations were determined with a protein assay kit (Bio-Rad), and the purity was assessed by SDS-PAGE.
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentration was determined using a Bradford protein assay kit (Bio-Rad).
-
bioRxiv - Molecular Biology 2020Quote: ... Exosomal protein content was estimated by BCA protein assay kit (Bio-Rad) and stored at -80°C for further usage.
-
bioRxiv - Microbiology 2022Quote: ... Protein concentration was determined with the Protein Assay Kit II (Bio-Rad), and 10-15 µg of protein was loaded into 12% acrylamide Criterion XT Bis-Tris Precast Gels (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein concentrations were measured using the DC Protein Assay Kit (Bio-Rad). 15-20 μg protein samples were run in SDS–PAGE followed by protein transfer using Mini Gel Tank and Mini Blot Module (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentration was measured using the DC Protein Assay kit (Bio-Rad), a detergent compatible modification of the Lowry method ...
-
bioRxiv - Plant Biology 2022Quote: ... The protein concentration was determined by a protein assay kit (Bio-Rad) using bovine serum albumin as standard (Han ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein concentration was determined using the Dc protein assay kit (Bio-Rad). Membranes were blotted overnight at 4°C with the following primary antibodies ...
-
bioRxiv - Biochemistry 2022Quote: ... and protein concentration was determined using DC protein assay kit (Bio-Rad) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... the protein amount was quantified using the DC protein assay kit (Biorad) and the same amount of total lysate for each sample (apical ...
-
bioRxiv - Genetics 2023Quote: ... Protein concentration was measured with DC Protein Assay kit II (BioRad, 5000112) against a BSA standard curve and measured with Synergy H4 microplate reader ...
-
bioRxiv - Microbiology 2023Quote: ... Protein concentrations were quantified using the DC protein assay kit (Bio-Rad). Twenty-five micrograms (25 μg ...
-
bioRxiv - Biochemistry 2022Quote: ... After protein quantification with DC Protein Assay Kit (Bio-Rad, California, USA), equal amounts of C2 and C0 TRAP1 were treated with or without 50 mM DTT (Sigma-Aldrich ...