Labshake search
Citations for Bio-Rad :
1 - 50 of 10000+ citations for Human Ras Related Protein M Ras MRAS ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: Protein lysates (see “RAS activity assays”) were mixed with 4×Laemmli buffer (Cat.#161-0747; Bio-Rad Laboratories, Hercules, US) containing fresh 200 mM DL-Dithiothreitol (Cat.#3483-12-3 ...
-
bioRxiv - Biochemistry 2022Quote: ... h-Ras did not contain a HisTag and was purified on a Q-Sepharose column (Bio-Rad) in 20 mM Tris (pH 7.4) ...
-
bioRxiv - Immunology 2024Quote: ... ACPA IgG levels were quantified based on an in-house standard of pooled RA patient plasma using the Microplate manager software MPM-6 (Bio-Rad Laboratories, Inc.). Unspecific reactivity to the peptide backbone was assessed by applying CArgP2 ...
-
bioRxiv - Microbiology 2022Quote: ... and molecular weights were measured related to the proteins ladder (Precision PlusProtein All Blue Standards #1610373, Bio-Rad) using the Image Lab analysis software (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein pellet was resuspended in UTC buffer (8 M urea, 2 M thiourea, 4% CHAPS) and quantified using RC DC™ Protein Assay Kit (Bio-Rad). Sample with 80 µg proteins resuspended in rehydration buffer (8 M urea ...
-
bioRxiv - Molecular Biology 2019Quote: ... Measurement of serum cytokines was performed using multiplex ELISA (human 27-plex #m500kcaf0y, Bio-Rad).
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... The protein extract was solubilized in 2-D lysis buffer (30 mM Tris-HCl pH 8.8, containing 7 M urea, 2 M thiourea and 4% CHAPS. Protein concentration was measured using Bio-Rad protein assay method ...
-
bioRxiv - Immunology 2020Quote: Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Collected sera were subjected to ELISA by capturing with human anti-rituximab idiotype antibody (HCA186, Bio-Rad Laboratories), detected with rat-anti-rituximab-HRP antibody (MCA2260P ...
-
bioRxiv - Immunology 2021Quote: ... Protein 1ug/ml were immobilized onto NC membranes (0.22-m pore size; Bio-Rad). The membrane kept for drying for 5-10 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were quantified by DC Protein Assay Kit (BioRad). Gel electrophoresis was run in Criterion TGX Stain-Free Gels (BioRad) ...
-
bioRxiv - Evolutionary Biology 2019Quote: A commercial colorimetric protein assay kit (DCTM Protein Assay Kit, Bio-Rad, Hercules, USA) was used to quantify total protein content of the coral host tissue ...
-
bioRxiv - Cell Biology 2023Quote: ... cleared supernatant was transferred to the new clean Eppendorf tubes and total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Nuclear and cytoplasmic proteins were prepared using the NE-PER nuclear and cytoplasmic extraction reagent kit (Thermo Scientific™ ...
-
bioRxiv - Cell Biology 2023Quote: ... total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Samples were boiled for 10 min at 96 °C in 1X Laemmli buffer (LB ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were transferred onto a 0.45-m-pore-size polyvinylidene difluoride (PVDF) membrane (Bio-Rad, #1620177) and processed for immunoblotting ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein was quantified by DC Protein Assay kit (Bio-Rad). The same amount of protein (15 μg ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were determined using Protein Assay Kit (BioRad, 5000002). Prior to loading ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein assay was performed using DC Protein Assay kit (BioRad). One mg of total protein of each sample were immunoprecipitated with 50 ul of p53 antibody (D0-1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein assays were performed using DC Protein Assay kit (BioRad) and was used to load equivalent total protein on 4-15% gradient (SDS)-polyacrylamide gel (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein was quantified using the DC Protein Assay kit (BioRad) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentration was measured using DC protein assay kit (BioRad). The sample concentrations were normalized prior to the submission for the analysis by Eve Technologies DM-44 mouse Discovery Assay panel.
-
bioRxiv - Cell Biology 2024Quote: ... Protein concentration was determined by DC protein assay kit (Biorad). Protein samples were prepared in 1x Laemmli loading buffer (Biorad ...
-
bioRxiv - Microbiology 2020Quote: ... The precipitated proteins were then dissolved in 6 M urea/50 mM ammonium bicarbonate buffer (pH 8) for protein quantitation using DC™ protein assay (Bio-Rad Laboratories) and trypsin digestion.
-
bioRxiv - Plant Biology 2022Quote: ... Bradford protein assay kit (Bio-rad) was used to determine protein concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... A DC protein assay kit (BioRad) was used to determine the protein concentration of individual samples ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein concentrations were determined using a Bradford protein assay kit (BioRad). Exactly 30 or 100 μg of protein were separated on 10% polyacrylamide gels and then transferred onto membranes ...
-
bioRxiv - Molecular Biology 2019Quote: ... and protein concentration was measured using DC Protein Assay Kit (BioRad). Proteins of 20-30 µg were run on the SDS-PAGE gel ...
-
bioRxiv - Microbiology 2019Quote: Protein lysates were quantified using the DC protein assay kit (BioRad) and 20 μg lysate was electrophoresed for 2 hours at 100V through SDS-10% PAGE ...
-
bioRxiv - Developmental Biology 2021Quote: ... Protein concentration was determined using the DC protein assay kit (Biorad). Equal amounts of proteins (10-30ug ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein concentrations were measured with the DC protein assay kit (BioRad), and 10-15 ug of protein was loaded onto 4-12% NuPage BisTris gels (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein concentration was determined using a Bradford Protein Assay kit (Biorad). Proteins were separated by SDS-PAGE and transferred to polyvinyl difluoride (PVDF ...
-
bioRxiv - Developmental Biology 2022Quote: ... Protein concentration was determined by Dc Protein Assay kit (Bio-Rad). 20-50µg of proteins were analyzed by SDS/PAGE and transferred onto a nitrocellulose membrane ...
-
bioRxiv - Developmental Biology 2022Quote: ... Protein concentration was determined by Dc Protein Assay kit (Bio-Rad). 2-6 mg of total protein were used for HPLC-MS/MS by the Lipidomics Core at the Stony Brook University Lipidomic Core (https://osa.stonybrookmedicine.edu/research-core-facilities/bms Stony Brook ...
-
bioRxiv - Developmental Biology 2020Quote: ... Protein concentration was determined using a Pierce BCA protein kit (BioRad), following the manufacturer’s instructions ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... proteins were quantified using the DC Protein Assay Kit (Bio-Rad). Equal amounts of protein 10-20 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured using the DC protein assay kit (BioRad). Proteins were reduced by adding DTT to a final concentration of 5 mM and incubating for 30 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein concentrations were measured using a protein quantification kit (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein lysates were quantified using the DC protein Assay Kit (Biorad). For westerns on total cell lysates ...
-
bioRxiv - Systems Biology 2023Quote: ... Bradford protein assay (Bio-Rad Protein Assay Kit I, Bio-Rad) was used to determine the protein amount ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were measured using the DC protein assay kit (BioRad), and 20 ug of protein was loaded onto 4-12% NuPage BisTris gels (Invitrogen ...
-
bioRxiv - Systems Biology 2023Quote: ... Bradford protein assay (Bio-Rad Protein Assay Kit I, Bio-Rad) was used to determine the protein amount ...
-
bioRxiv - Systems Biology 2023Quote: ... Bradford protein assay (Bio-Rad Protein Assay Kit I, Bio-Rad) was used to determine the protein amount ...
-
bioRxiv - Systems Biology 2023Quote: ... Bradford protein assay (Bio-Rad Protein Assay Kit I, Bio-Rad) was used to determine the protein amount ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein quantification was done using DC protein assay kit (Bio-Rad) according to the manufacturer’s instructions with bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein concentrations were estimated calorimetrically by DC protein assay kit (BioRad). For SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... Purified proteins were quantified by Bradford protein assay kit (Bio-Rad) and validated by SDS-PAGE followed by staining with Coomassie brilliant blue ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatants containing the protein extracts were transferred into fresh 1.5 ml tubes and protein concentration was measured by Bio-Rad Protein Assay Kit using BSA as protein standard (5000002; Bio-Rad). From each sample ...
-
bioRxiv - Cell Biology 2023Quote: ... and protein concentration was estimated by DC protein assay kit (BioRad). For SDS-PAGE ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein concentration was measured using DC Protein Assay Kit (Bio-Rad) and an equal amount of protein was loaded in 8% gel ...