Labshake search
Citations for Bio-Rad :
101 - 150 of 4584 citations for Human Matrix Metalloproteinase 13 Collagenase 3 MMP13 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... BAC plasmid DNA was extracted by alkali.13 Native and digested BAC DNA was separated using CHEF mapper (Bio-Rad, Hercules, CA).
-
bioRxiv - Cell Biology 2020Quote: ... and detected using the antibodies listed in Supplementary File 3 with either SuperSignal West Dura or SuperSignal Femto kits (Pierce, Waltham, MA) and a ChemiDoc XRS imaging system (Bio-Rad). Band intensities were quantified using ImageLab software (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... membranes were washed again 3 times 10min in 1X TBS-T and developed using the Clarify Western ECL substrate kit (Bio-Rad) or SuperSignal West Femto (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Zoology 2022Quote: ... sfRNA and 3’UTR were quantified together by RT-qPCR using the iTaq Universal Sybr green one-step kit (Bio-Rad) with primers previously designed [26] ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were then exposed to the ECL substrate kit (Pierce 34850 and 34095) for 3 minutes before imaging with the ChemiDoc Touch Imaging System (Bio-Rad).
-
bioRxiv - Evolutionary Biology 2020Quote: ... was extracted from several colonies of a 6-week-old subculture on Coletsos culture medium using the InstaGene matrix following the manufacturer’s instructions (Bio-Rad, Marnes-la-Coquette, France). Then ...
-
bioRxiv - Genetics 2020Quote: ... and was quantified by using a QuantifilerR Human DNA Quantification Kit (Applied Biosystem, USA) on a Bio-Rad Real-time PCR System (Bio-Rad Laboratories, USA). The quantification process was performed per the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: PDEC cytokine secretion was analyzed from cleared PDEC culture supernatants using Bio-Plex Pro Human Cytokine 27-plex assay kit (Bio-Rad, cat. M500KCAF0Y) and Bio-Plex 200 System (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... Cytokine levels in cell culture supernatants was determined using the Magnetic Luminex Performance Assay (Human Base Kit A; R&D Systems, coupled with the Bio-Plex 200 (Bio-Rad). The trimmed median value was used to derive the standard curve and calculate sample concentrations.
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: After 9-13 days in culture, organotypic hippocampal slices were transfected biolistically with gene gun (McAllister, 2000) using gold beads (Bio-Rad, 1.6 µm) coated with plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... Protein samples were separated by gel electrophoresis using 13% Tris-Tricine polyacrylamide gels and either transferred to a 0.45-μm nitrocellulose membrane (Bio-Rad Laboratories, Hercules CA) or stained with Coomassie blue (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from the isolates using the InstaGeneTM Matrix comprising 6% (w/v) Chelex resin for PCR-ready DNA purification (Bio-Rad #7326030; California, United States). DNA quality was checked by measuring the A260/280 ratio using NanoDrop ...
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Microbiology 2020Quote: ... Levels of the following 27 cytokines were analyzed using a BioPlex Pro™ Human Cytokine 27-plex Assay kit (#M500KCAF0Y, Bio-Rad, Hercules, CA, USA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Physiology 2022Quote: ... real-time quantitative polymerase chain reaction (RT-qPCR) was executed with 13 ng cDNA using SSO advanced SYBR Green supermix (Bio-Rad Laboratories, Hercules, CA, USA) with the following settings ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg RNA was transferred into the cDNA Ecodry Premix Kit prior to the quantitative PCR program being run on ABI QuantStudio 3 with iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, 1725121). Each reaction proceeded at 50 °C for 2 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...