Labshake search
Citations for Bio-Rad :
1 - 50 of 4564 citations for Human Galectin 3 LGALS3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Measurement of serum cytokines was performed using multiplex ELISA (human 27-plex #m500kcaf0y, Bio-Rad).
-
bioRxiv - Cancer Biology 2019Quote: ... Collected sera were subjected to ELISA by capturing with human anti-rituximab idiotype antibody (HCA186, Bio-Rad Laboratories), detected with rat-anti-rituximab-HRP antibody (MCA2260P ...
-
bioRxiv - Microbiology 2019Quote: ... and plates were read 3 times at 450 nm in the model microplate ELISA reader (BIO-RAD, Japan). Negative controls (coated with naive sera ...
-
bioRxiv - Immunology 2020Quote: Multiplex ELISA (Biorad; CA, USA) was performed to detect cytokines in BALF ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Molecular Biology 2022Quote: ... ELISAs were performed with the Bio-Rad TeSeE Short Assay Protocol (SAP) Combo Kit (BioRad Laboratories Inc., Hercules, CA, USA). Importantly ...
-
bioRxiv - Microbiology 2021Quote: Luminex profiles utilized the Human Inflammation Panel 1 37-plex assay kit (Bio-Rad) per the manufacturer’s protocol using the laboratory multianalyte profiling system (MAGPIX ...
-
bioRxiv - Immunology 2023Quote: ... and chemokines dosage by Luminex using the 48-Plex pan-human cytokine kit (BioRad) according to the manufacturer procedure ...
-
bioRxiv - Microbiology 2022Quote: ... The absorbance was read using ELISA reader (BIO-RAD). The detection ranges for TNF-α ...
-
bioRxiv - Microbiology 2021Quote: ... ELISA reading was taken in iMark plate reader (BioRad). Standard curve was generated from ODs of known dilutions of NS1-Ag ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the Bio-Plex Pro™ Human Inflammation Panel-1 Kit (37-Plex, Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... ELISA plates were read on iMark™ Microplate Reader (BioRad) and data analyzed with Excel.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Immunology 2024Quote: ... 17 human cytokines were analysed simultaneously using the kit and run on the Luminex analyser (BIORAD), standard curves for each cytokine created and per cytokine concentrations calculated using the BioRad software.
-
bioRxiv - Immunology 2024Quote: Cytokines were measured in cell culture supernatants using luminex analysis (Biorad human 17-plex Bioplex kit) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration of VSW-3 RNAP was determined by Bradford protein quantitative kit (Bio-rad), and protein purity and concentration were analyzed along with T7 RNAP (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Immunology 2023Quote: ... Serially diluted recombinant human IgG1 or human IgG4 (BioRad, Hercules, CA) with unrelated specificities were used for quantification in separate wells on the same plate.
-
bioRxiv - Microbiology 2023Quote: ... and the absorbance was read using an ELISA reader (BIO-RAD) at 450 nm and 570 nm dual filters.
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 × 10 min with TBST and exposed with a ECL kit (Bio-rad, cat # 1705061) on X-ray films (Kodak ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA) INSR - PrimePCR™ SYBR® Green Assay ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Human (Bio-Rad, USA). Resultant data was analysed using the proprietary LightCycler® Software 4.1 and Microsoft Excel ...
-
bioRxiv - Immunology 2020Quote: ... human CD68 (BioRad MCA5709), human ACE2 (Abcam ab15348) ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were read on a model 680 microplate reader (Bio-Rad) at 450 nm.
-
bioRxiv - Microbiology 2020Quote: ... This was read at 540 nm on an ELISA reader (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... a sandwich ELISA was performed using a matched antibody pair (BioRad, France) as previously described (Totté et al. ...
-
bioRxiv - Microbiology 2023Quote: ... GM testing with the Platelia enzyme-linked immunosorbent assay (ELISA) (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2020Quote: Human plasma was analysed using the human 27-plex cytokine panel (Bio-Rad) according to manufacturer’s instructions and contained the following targets ...
-
bioRxiv - Physiology 2023Quote: ... each fiber was carefully submerged in 3 µL of lysis buffer (SingleShot Cell Lysis kit, Bio-rad), containing proteinase K and DNase enzymes to remove unwanted proteins and DNA ...
-
bioRxiv - Biophysics 2023Quote: Apoptosis was probed using the Bio-Rad Magic Red Caspase 3-7 kit (Bio-Rad, ICT 935). HEK 293T cells stably expressing FGFR1-YFP were seeded in 96 well plates and allowed to grow to ∼70% confluency ...
-
bioRxiv - Cell Biology 2020Quote: ... PP2A activity was measured using an ELISA reader (Bio-rad xMARK microplate spectrometer) at a wavelength of 650 nm.
-
bioRxiv - Synthetic Biology 2021Quote: ... OD490nm was determined using a microplate reader (iMark ELISA plate reader, Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... Next morning plates were washed with an ELISA plate washer (ImmunoWash 1575, BioRad) using 0.25 mL wash solution/well (DPBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... ELISA-based signaling measurements were performed according to the manufacturer’s instructions (Bio-Rad). The Luminex kits EGFR Y1068-p and p-AKT is S473-p were obtained from Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... human TGFβ1 (PHP143B, Bio-Rad), anti-IL11 antibody (X203 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCID0017132) and ACTB - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0036269). The cycles to threshold was measured for each well ...
-
bioRxiv - Cell Biology 2024Quote: ... Human (BioRad-assay ID qHsaCED0044963) INSR - PrimePCR™ SYBR® Green Assay ...
-
bioRxiv - Neuroscience 2022Quote: Cytokines were quantified in media isolated from MN cultures using the Bio-Plex Pro Human Cytokine kit (Biorad, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... Absorbance of the suspension was measured at 570nm using ELISA plate reader (BioRad, USA). Cellular cytotoxicity was determined in duplicates and each experiment was repeated thrice independently.
-
bioRxiv - Immunology 2021Quote: ... The absorbance at 450 nm was measured by an ELISA plate reader (Bio-Rad). The endpoint serum dilution was calculated with curve fit analysis of optical density (OD ...
-
bioRxiv - Immunology 2023Quote: ... The plates were developed with TMB ELISA substrate solution (Bio-Rad Laboratories, Hercules, CA) and stopped using 1 N sulfuric acid ...
-
bioRxiv - Cancer Biology 2019Quote: ... ScRNA-Seq libraries were prepared using SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina/Bio-Rad) according to manufacturer’s manual ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase activity was measured as described in the FAM FLICA caspase 1 and 3 kit (Bio-Rad, Hercules, USA). Lysosomal and mitochondrial content as well as production of ROS were analysed by staining with 50 nM LysoTracker™ Deep Red ...
-
bioRxiv - Immunology 2021Quote: ... rat anti-human CD8 (Bio-Rad), rat anti-human Granzyme B (eBioscience) ...
-
bioRxiv - Genetics 2023Quote: ... Human (Bio-Rad, 10031243, ID: dHsaCP1000002). Reference assay for 3.1 kb deletion and 3.1 kb inversion assays ...