Labshake search
Citations for Bio-Rad :
51 - 100 of 3434 citations for HCC 4 CCL16 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4% CHAPS and deStreak (BIORAD, Australia). Two equilibration steps were carried out in SDS equilibration buffer consisting of SDS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Lastly 4 μl TEMED (Bio-Rad) and 6 μl freshly prepared Ammonium persulfate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 4-20% precast gels (BioRad). Gels were transferred onto Immobilon-P PVDF membrane (EMD Millipore) ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein separation was performed on Mini-Protean TGX (4-15% or 4-20%) SDS-PAGE gel (Bio-Rad) and transferred to PVDF membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).
-
bioRxiv - Immunology 2022Quote: ... incubated for five days at 4°C in 40 mL of hydrogel monomer solution [4% acrylamide (Bio-Rad), 0.05% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... and resolved by SDS-PAGE using Criterion XT Bis-Tris precast gels (4-12%; BioRad, 3450123/4/5) and XT-MES1X as running buffer (stock 10X ...
-
bioRxiv - Cancer Biology 2023Quote: ... All western blots were run using PROTEAN TGX precast 4-15% or 4-20% gradient gels (Bio-Rad) and transferred to either 0.2μm or 0.44μm nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM tris ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 4-15% Mini Protean gels (BioRad). Proteins were transferred to nitrocellulose membrane using Turbo-blotter (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 4% goat (Bio-Rad Laboratories, #C07SA) or donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2020Quote: ... Polyacrylamide gels (Bio-Rad, 4-16 wt%). IFNγ ELISA (DY485 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4-15% (BIO-RAD #456-1083) Mini PROTEAN® gel in Tris/Glycine/SDS (BIO-RAD #1610772) ...
-
bioRxiv - Neuroscience 2022Quote: Criterion TGX 4-15% (Bio-Rad 5671084) and Mini-Protean TGX precast gels (Bio-Rad 4561083 ...
-
bioRxiv - Molecular Biology 2021Quote: 4-20% precast SDS PAGE gels (BioRad) were used for electrophoretic separation of immuno purified samples ...
-
bioRxiv - Immunology 2021Quote: ... 4-15% gradient gels (Bio-Rad 4561086) and transferred to PVDF membranes (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... run on 4-20 % polyacrylamide gels (BioRad) according to manufacturer’s instructions and analyzed by adding InstantBlue (Expedeon).
-
bioRxiv - Microbiology 2019Quote: ... loaded on 4-20% polyacrylamide gels (BioRad), and transferred to Immobilon-P Transfer Membranes (Millipore Corp) ...
-
bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
bioRxiv - Genetics 2021Quote: ... 4% (wt/vol) acrylamide (Bio-Rad, USA), 0.05% (wt/vol ...
-
bioRxiv - Neuroscience 2021Quote: ... 4% w/v acrylamide (Bio-Rad 1610140), 0.05% w/v bis-acrylamide (Bio-Rad 1610142) ...
-
bioRxiv - Plant Biology 2020Quote: ... in 4-mm electroporation cuvettes (Bio-Rad) with the following setting ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad, Hercules, California), and in the case of immunoblot analysis ...