Labshake search
Citations for Bio-Rad :
701 - 750 of 1910 citations for Goat Anti Human IgM since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... A goat anti-rabbit IgG (H+L) and goat anti-mouse IgG (H+L) antibody with HRP conjugate (1706515 and 1706516, respectively, Bio-Rad, Hercules, CA) was used as a secondary detection antibody ...
-
bioRxiv - Cancer Biology 2020Quote: ... incubated with 3% H2O2 for 15 min at room temperature and then incubated with goat anti-rabbit IgG-HRP (Bio-Rad 170-6515) secondary antibody diluted 1:300 in the blocking buffer for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibodies used were Immun-Star goat anti-rabbit (GAR)-HRP Conjugate (Cat # 170-5046, or Cat#170-6515; Bio-Rad Laboratories, USA). Clarity Western ECL Substrate (cat #170-5061 ...
-
bioRxiv - Molecular Biology 2023Quote: ... at room temperature for 1 h with slight shaking and SP-A-S protein or SP-A-RBD complexes were detected by adding HRP-conjugated Goat Anti-rabbit IgG (1:2000, Bio-rad, Hercules, USA) for an additional 1 h ...
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Cell Biology 2023Quote: ... goat α-mouse IgG HRP (Bio-Rad, 1721011) or goat α-rabbit IgG HRP (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
SHARPIN enhances ferroptosis in synovial sarcoma cells via NF-κB- and PRMT5-mediated PGC1α reductionbioRxiv - Cancer Biology 2023Quote: ... the membranes were washed with TBS and incubated for 1 hour at room temperature with the secondary antibody (HRP-conjugated goat antirabbit or goat antimouse antibody) (Bio-Rad). Protein bands were visualized and quantified using Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... The plate was washed 3 times prior to adding 50 μl of 1:1000 diluted Goat anti-Mouse IgG H+L-HRP antibody (Bio-Rad, Cat# 172-1011) to the plate and incubated for 1 h at RT ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... After overnight incubation membranes were washed three times with 1x TBST for ten minutes per wash and then incubated with a secondary goat anti-rabbit antibody (BioRad Cat#1706515, 1:10000) for one hour with rocking at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and incubated with goat anti-rabbit IgG-alkaline phosphatase-conjugate secondary antibody (Bio-Rad, 1:3000 dilution) for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were then washed thrice with TBST (5 minutes/wash) at room temperature and then incubated with HRP-conjugated goat anti-rabbit IgG (H + L) (Bio-Rad, Cat #: 170-6515) or goat anti-mouse IgG (H + L ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Cell Biology 2022Quote: ... in PBS and incubated overnight at 4°C in primary antibodies: anti-human actin-β primary monoclonal antibody produced in mouse (1:100; Bio-Rad Laboratories Inc. MCA57766A) and non-muscle myosin II produced in rabbit (1:100 ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat α-rabbit IgG-HRP (Biorad, 1706515, RRID:AB_11125142). Immunoreactive bands were visualized using SuperSignal West Pico Plus Chemiluminescent Substrate (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... or goat α-rabbit IgG HRP (Bio-Rad, 1706515)] for 2 h at RT with shaking ...
-
A novel Hsp90 phospho-switch modulates virulence in the major human fungal pathogen Candida albicansbioRxiv - Microbiology 2020Quote: ... Both primary antibodies were diluted 1:5,000 in PBST with 0.2% milk and subsequently conjugated with α-rabbit antibody-HRP conjugate (BioRad Immun-Star Goat Anti-Rabbit (GAR)-HRP Conjugate #1705046 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Cell Biology 2021Quote: ... Horseradish peroxidase - conjugated goat secondary antibodies were from Bio-Rad. Alexa Fluor-conjugated goat antibodies against mouse or rabbit IgG (1:500 for IF ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Genomics 2020Quote: ... and Goat α-mouse secondary (Bio-Rad Laboratories, Hercules, CA, 1706516) at a 1:5,000 dilution were used within milk as blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... probed with goat α-rabbit HRP-conjugated secondary antibody (Bio-Rad) at a 1:2000 dilution in TBS-T for 45 min at room temperature with shaking ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibodies were goat α-mouse IgG-HRP (Biorad, 1706516; RRID:AB_11125547), goat α-mouse IgG2b-HRP (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... and secondary goat antimouse IgG antibody conjugated to Alkaline Phosphatase (BioRad) were used.
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.
-
bioRxiv - Cancer Biology 2021Quote: ... and resuspended in FACS buffer with Fc-block (Human Seroblock, Bio-Rad). These samples were then re-pelleted and suspended in a cocktail of fluorophore-conjugated primary antibodies (Supp ...
-
Antiviral roles of interferon regulatory factor (IRF)-1, 3 and 7 against human coronavirus infectionbioRxiv - Microbiology 2022Quote: ... human IFN-γ and IFN-λ 1 were obtained from Bio-Rad, BD Pharmingen and R&D Systems respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... and G-CSF quantification using a human Bio-plex PRO assay (Biorad) following the manufacturer’s instructions and acquired with the Luminex200 instrument (Luminex).
-
bioRxiv - Immunology 2023Quote: ... A human RPP30 copy number assay labeled with HEX (Bio-Rad, dHsaCP1000485) was used to measure total allelic copy numbers ...
-
bioRxiv - Immunology 2023Quote: ... with human IgA positive and negative controls (Bio-Rad, Cat No. 12014775), Bio-Plex SARS-CoV-2 Wuhan-1 strain RBD and N coupled beads (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-Rad using HuCAL technology ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-rad using the HuCAL technology ...
-
bioRxiv - Bioengineering 2022Quote: ... and goat antimouse conjugated to HRP as a secondary antibody (Bio-Rad) followed by colorimetric detection using the Opti-4CN Kit (Bio-Rad).